ID: 917638706

View in Genome Browser
Species Human (GRCh38)
Location 1:176961395-176961417
Sequence CCTGTAGGGGAAGCAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917638697_917638706 22 Left 917638697 1:176961350-176961372 CCATGTTAATAAGAAAAGCAGCC 0: 1
1: 0
2: 0
3: 20
4: 253
Right 917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG 0: 1
1: 0
2: 0
3: 26
4: 160
917638700_917638706 1 Left 917638700 1:176961371-176961393 CCTCTGGTAAGATCAAGGTGAAA 0: 1
1: 0
2: 0
3: 42
4: 158
Right 917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG 0: 1
1: 0
2: 0
3: 26
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917638706 Original CRISPR CCTGTAGGGGAAGCAAAGTC AGG Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904622841 1:31785587-31785609 CCTGTGAGGGAAGCCAAGTCAGG + Intergenic
904634469 1:31869177-31869199 CCTGTGGAGGAAGCAGACTCAGG + Intergenic
905295823 1:36953852-36953874 CCTGGAGGGGAAGCACAGAGGGG + Intronic
906286345 1:44590281-44590303 CCTGCTGGGCAAGGAAAGTCCGG + Intronic
908501336 1:64745694-64745716 GCCGTAGGGGAAGGAAAGACCGG - Intronic
909341268 1:74534004-74534026 CGTTTTGGGGATGCAAAGTCAGG - Intronic
910161608 1:84278243-84278265 CCTGGAGAGGAAGCAAAGAGGGG + Intergenic
911195285 1:94988265-94988287 GCTGAACAGGAAGCAAAGTCAGG + Intronic
912179018 1:107195394-107195416 ACTGAAGGGGAGGCAAAGGCAGG - Intronic
912260633 1:108108683-108108705 TCTCTAGGGGAAGCAAATTGTGG - Intergenic
912978940 1:114353336-114353358 CGTGCAGGGGAAGCTCAGTCAGG + Intergenic
916674778 1:167055849-167055871 GCTGCAGGGGAAGAAGAGTCAGG + Exonic
917040994 1:170806304-170806326 TCTGTTGGGGAAGAAAAGTCAGG + Intergenic
917499858 1:175576287-175576309 CCTGAAAGAGATGCAAAGTCAGG + Intronic
917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG + Intronic
918382232 1:183967758-183967780 CCAGGATGGGAAGCAAAGTCAGG - Intronic
920250466 1:204619275-204619297 CCTGGAGGGGCTGCAAAGCCTGG - Exonic
920812751 1:209302704-209302726 CCTGTCTGGGAAGAAAAGTTGGG + Intergenic
920817820 1:209351541-209351563 CCTGGAAGGGAAGCAAAGCTTGG - Intergenic
920920558 1:210294261-210294283 CCTGTATGGGAAGCCAAGGTGGG - Intergenic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
921606987 1:217167402-217167424 CCAGTAGGAGATGCAAAGGCAGG - Intergenic
924611571 1:245577896-245577918 CTTGTAGGGGAAGCATCGCCCGG - Intronic
1065428155 10:25627303-25627325 CCTGAAGAGGAAGGAATGTCAGG - Intergenic
1065997078 10:31069368-31069390 CCGGTAGAGGAAGACAAGTCTGG + Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1067569285 10:47359915-47359937 CCTGGAGGGGAAAGAAAGGCAGG - Intergenic
1071114172 10:82197604-82197626 CCTTTAGGGAAAACAAAGACAGG - Intronic
1073342139 10:102753336-102753358 CCACTAGGTGGAGCAAAGTCTGG + Intronic
1075146302 10:119885719-119885741 GCTGTAGGGGGAGGAAAGTTTGG + Intronic
1075177464 10:120178861-120178883 CCAGTAGGAGAACCAAAGACAGG - Intergenic
1075339786 10:121637376-121637398 CCTGCAAGGGAAAAAAAGTCAGG - Intergenic
1076239007 10:128888146-128888168 CCTGAAGGGGAAGGAAAATCTGG + Intergenic
1076337189 10:129714932-129714954 CCTGTAGCAGAAGCATAGTTAGG + Intronic
1083047429 11:59749373-59749395 CCTGGAGGAGAACCACAGTCAGG - Intronic
1084876243 11:72135825-72135847 CCTGTAGGGGATGCAGGGTGGGG + Intronic
1084881113 11:72172321-72172343 CCTGTAGGGGATGCAGGGTGGGG + Intergenic
1085234701 11:75005576-75005598 ACTGTAGATGAAGCAAAGGCGGG - Exonic
1087850739 11:103026802-103026824 GCAGGAGGGGAAGCACAGTCTGG + Intergenic
1088070919 11:105784002-105784024 TATGTAGAGGAAGCAAAGTCAGG - Intronic
1089151771 11:116369920-116369942 CTTGGATGGCAAGCAAAGTCCGG + Intergenic
1090145802 11:124321093-124321115 ACTTTAGGGGAAACGAAGTCAGG - Intergenic
1091196544 11:133736266-133736288 CCTGTACAGGAAGCAGAGTGAGG + Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1093276179 12:17130704-17130726 CCTTTAGGTGAAGCAAGGTGAGG + Intergenic
1096683034 12:53269504-53269526 GCTGTTGGAGAAGCAAAGTGAGG - Exonic
1097376500 12:58849354-58849376 TCTGTAGGGGAAGGAAAGGCAGG - Intergenic
1101747032 12:107550299-107550321 CCTTTAGGGGAAACAATGACAGG - Intronic
1102608986 12:114094748-114094770 CCTGCAGGGGCAGCCAAATCTGG + Intergenic
1104382398 12:128318954-128318976 GCTCTAGGGGAAGTAAGGTCTGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1105723086 13:23135350-23135372 CCAGTGGTGGAAGCAAAGTAGGG - Intergenic
1105775670 13:23657969-23657991 CCTGCCGGGGAAGCAGAGTGAGG + Intronic
1105865484 13:24454972-24454994 CATGTAGGGGAAGCACACGCAGG + Intronic
1114447934 14:22803863-22803885 CCTGTAGGGAACGCACAGTGTGG - Intronic
1114552106 14:23538694-23538716 CCTTCAGAGGAAGCAATGTCAGG - Intronic
1115343498 14:32317738-32317760 TGTGTAGGGGAAGAAAGGTCTGG - Intergenic
1117886427 14:60369064-60369086 TCTGTAGGGGAAGGAAGGCCTGG - Intergenic
1118611873 14:67547638-67547660 CCTGTAGGGTGAGCAAAGCCTGG + Intronic
1120057716 14:79944949-79944971 CATTTAGGGGAAGAAAAGTCAGG + Intergenic
1121456022 14:94039307-94039329 CCTGTGGTGGAAGCAGAGGCTGG - Intronic
1122386200 14:101350005-101350027 CCTGTAGAGTAGGCAAAGGCTGG - Intergenic
1122401399 14:101469582-101469604 GCTGTGGGGGAAGCACAGCCTGG - Intergenic
1126141639 15:45444180-45444202 CCTGAGAGGGAAGCAAATTCTGG + Intronic
1127190407 15:56524805-56524827 CCTCTATGGGAAGCAAAGAATGG + Intergenic
1128298715 15:66548825-66548847 CCTGTAGAAGAACCAAATTCAGG - Exonic
1128338824 15:66805556-66805578 TGTGCAGGGGAAGCAAAGCCAGG - Intergenic
1131057196 15:89382365-89382387 CCTGTAAGCTAAGCAAGGTCAGG - Intergenic
1131341039 15:91601134-91601156 CCTGAAAGGGAAACAAAGTGAGG - Intergenic
1131454762 15:92574931-92574953 ACTGCAGGAGAAGCAAATTCTGG - Intergenic
1132713726 16:1280297-1280319 CCTGTATGGGGAGGACAGTCAGG + Intergenic
1133137999 16:3725571-3725593 CCAGGAGGGGAAGCACAGGCCGG - Exonic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1137056218 16:35747806-35747828 CCTGAAAGGTAAGCAAGGTCAGG + Intergenic
1139704803 16:68733916-68733938 CAATTAGGGGCAGCAAAGTCAGG - Intergenic
1140604175 16:76515130-76515152 CATGAAGAGGAAGAAAAGTCAGG + Intronic
1142438833 16:90080739-90080761 TCAGTTTGGGAAGCAAAGTCAGG - Intronic
1143506282 17:7367364-7367386 GATGTAGGGGAAGCACAGCCCGG - Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1144729677 17:17519233-17519255 CCTGGAGGGGAAGAACAGTGGGG + Intronic
1147426637 17:40348871-40348893 CCTGAAGGGGAAGCTAAGGCAGG - Intronic
1148160415 17:45446777-45446799 TGTGTAGGGGAAAAAAAGTCTGG + Intronic
1148560690 17:48604280-48604302 CCTGGAGGGGGAGCCAAGGCAGG - Intronic
1149492340 17:57094239-57094261 GCTGAAGGGGAAGCAGAGCCAGG - Intronic
1150391703 17:64793656-64793678 TGTGTAGGGGAAAAAAAGTCTGG + Intergenic
1151205430 17:72502886-72502908 CCTGAACAAGAAGCAAAGTCAGG + Intergenic
1151955297 17:77377073-77377095 CTTGAAGGGGGAGCAAAGGCGGG - Intronic
1153301643 18:3596977-3596999 CCTGTGGGGGAGGCCAAGTGGGG - Intronic
1153684808 18:7535313-7535335 CTTCTAGGAGAAGCAAAATCTGG - Intergenic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164813757 19:31178431-31178453 CCTGTAAGGGAGGCCAAGTCAGG + Intergenic
1165560272 19:36673143-36673165 CCAGAAGAGGATGCAAAGTCTGG - Intergenic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1168187528 19:54709533-54709555 CCTGGAGGGAAAGAAGAGTCGGG - Intergenic
925306096 2:2849064-2849086 CCTGTGGGGGAAGGGAAGTCAGG + Intergenic
925522781 2:4766225-4766247 CCAGAAGGGGAAGCACACTCGGG + Intergenic
925905010 2:8535096-8535118 CCTGCAGGGTCAGCAAAGACAGG + Intergenic
927806912 2:26156143-26156165 CCTGTACGGGAGGCTAAGGCAGG + Intergenic
928783321 2:34850925-34850947 CCTGCAGGGGAAAAAAGGTCGGG + Intergenic
929597734 2:43186840-43186862 CTTGTTGGGGAATCAAAGGCTGG - Intergenic
933838474 2:86265240-86265262 ACTGTTGGGGAAACAAAGTTTGG + Intronic
934927078 2:98389482-98389504 CCTGTAGGGGAAGGCAGGCCAGG - Intronic
938580763 2:132644550-132644572 GTTTCAGGGGAAGCAAAGTCAGG - Intronic
941064886 2:160890711-160890733 CCTGTATGGGAAGTAGAGTCAGG + Intergenic
941180927 2:162258463-162258485 CCTGTTGGGGAAGCCAAGTGAGG - Intergenic
942067823 2:172288402-172288424 CCTATAAGGGAAGAAAACTCAGG - Intergenic
942613980 2:177770583-177770605 CCTGGAGGTGCAGCAAAATCTGG + Intronic
944034114 2:195272407-195272429 CCTGTATGAGAAACAAAATCTGG + Intergenic
944710851 2:202333802-202333824 CGGGGAGGGGAAGCAAAGTGGGG + Intergenic
946480472 2:220051250-220051272 CCTGTTGGGGAAGCAGAGGGGGG - Intergenic
947953197 2:234165397-234165419 CCTGGAGGGGAAGACAAGTGGGG - Intergenic
1168835479 20:874503-874525 CCTGGAGGGGAAGCCCAGCCTGG - Intronic
1170618399 20:17973528-17973550 CCTGTAGAGGAAGCTGAGACAGG + Intronic
1173317627 20:41959334-41959356 CCTGGAGGAGAAGCTAAGTCAGG + Intergenic
1173397922 20:42698097-42698119 CCTTTAGGGGAATCAAAGGTAGG - Intronic
1174731522 20:52922777-52922799 CCTGTAGGGGAAGTAATGGGGGG - Intergenic
1175500382 20:59445926-59445948 CCTGTAGGGGAATGAAAGAGAGG + Intergenic
1179593410 21:42426675-42426697 CCTGCAGGGGAAGGAAAGCACGG - Exonic
1179926271 21:44535983-44536005 CTTGGAGTGGAAGCAAAGTTGGG - Intronic
1180619172 22:17148560-17148582 CCTGTAGGGACAGCCAAGACAGG + Exonic
1181590508 22:23882396-23882418 CCTGTAGGGGGACCAAAGAGGGG + Intronic
1183291170 22:37002815-37002837 CTTGCATTGGAAGCAAAGTCTGG - Intronic
1184592113 22:45491765-45491787 CCTGTAGTGGAAAGAAAGCCGGG + Intergenic
953635612 3:44661386-44661408 CCTGTAGGGGAGACAAAGAAAGG + Intergenic
955514994 3:59717562-59717584 GCTATCGGGGAACCAAAGTCAGG + Intergenic
961031172 3:123605190-123605212 CCTGTAGTGGAGGCTAAGGCAGG + Intergenic
963053448 3:141162528-141162550 CCATTAGGGGAAGCAATGTGGGG + Intergenic
967251685 3:187546605-187546627 GGTGTAGGGGAAGCAAAGGAAGG - Intergenic
968055078 3:195685047-195685069 CCTGTTGGGGAGGCCAAGACAGG - Intergenic
968100822 3:195964170-195964192 CCTGTTGGGGAGGCCAAGACAGG + Intergenic
969216978 4:5730750-5730772 CAGGTAGGGGGACCAAAGTCTGG + Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
975496740 4:75043906-75043928 CCTTTAGGGAAAGCAAACTGTGG + Intronic
976855364 4:89598251-89598273 CTTGTTGGGGAAGCGAAGTCAGG - Intergenic
977993454 4:103473802-103473824 CCTGTAGGGGAAGGAAAGGGAGG - Intergenic
979787549 4:124735049-124735071 CCTGAAGGAAAAGTAAAGTCGGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
982979423 4:162113349-162113371 TTTGGAGGGGAAGCAAAGTTTGG - Intronic
983378348 4:166958326-166958348 ACTGTAAGGGAAGCACAGTGGGG - Intronic
985564059 5:606519-606541 CCTGGAGGGGAAGCAGAAGCCGG - Intergenic
985894409 5:2740081-2740103 CCTGGAGGGGAAACCCAGTCGGG - Intergenic
986071727 5:4291807-4291829 CCAGAAGGGTCAGCAAAGTCAGG - Intergenic
991119875 5:62999859-62999881 CCAGTAGGGGTAACAAAGTCAGG + Intergenic
991310042 5:65228711-65228733 CCTGTGGGAGAATCAAAGGCTGG - Intronic
999414908 5:151386624-151386646 TCTGTTGGGCAAGGAAAGTCAGG - Intergenic
1000853062 5:166363850-166363872 CCTGCAAGGGAACCAAGGTCTGG - Intergenic
1003897542 6:10622020-10622042 CCTGTAGGGGGAGCAGGGACTGG - Intronic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1010942558 6:81935766-81935788 CCTGTATGGAAAGGAAAGTGGGG - Intergenic
1011053582 6:83181497-83181519 CAGGTGGGGAAAGCAAAGTCAGG - Intronic
1014320813 6:119925890-119925912 CCTGTAGGAGAAGAAAAATTAGG - Intergenic
1017223343 6:151991808-151991830 CCTGGAGGGGAAGAAAGCTCAGG - Intronic
1022507526 7:30916065-30916087 CCTAAAGGGGAAGCAGCGTCAGG - Intronic
1024895743 7:54259562-54259584 CCTGGAGGGGAGGTAAAATCTGG + Intergenic
1025034868 7:55587749-55587771 CCTGTGGAGGAAGCACAGTCAGG - Intergenic
1026166597 7:67915693-67915715 CCTGTAGGGTAAGAATAGACTGG - Intergenic
1027308770 7:76930875-76930897 CTTCTAGGGGAAGAAAAATCAGG - Intergenic
1029957234 7:104652716-104652738 GCTGCAGGAGAAGCAAAGCCAGG + Intronic
1031503636 7:122553607-122553629 CCATTAGGGGAAACAAAGTTAGG - Intronic
1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG + Intronic
1037772348 8:21809955-21809977 ACTGTAGGAGAAGCAACATCTGG - Intronic
1038482815 8:27913396-27913418 CCTGTAGGTGAAGCAATCTCAGG + Intronic
1040453580 8:47573591-47573613 GTTGGAGGAGAAGCAAAGTCTGG + Intronic
1040623270 8:49114330-49114352 TCTGCAGGGGAAGCAAAGCTGGG - Intergenic
1046051232 8:109024856-109024878 CCTGTAGTGGAAGAAAAGCCAGG - Intergenic
1046617787 8:116496555-116496577 TCTGTAGAGGAAGAAAAGTTAGG + Intergenic
1049011055 8:139887670-139887692 CCTGCAGGAGAAGCAAGGTCAGG - Intronic
1050045597 9:1541572-1541594 CCTGCAGGCAAAGCAAAGGCTGG + Intergenic
1053436838 9:38081360-38081382 CATGTAGGGGCAGAAAGGTCTGG + Intergenic
1056486177 9:87060156-87060178 CCTGTTTGTGAAGCAAATTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1062355238 9:136158768-136158790 CCTGTGGGAGAAGCACAGCCAGG + Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1193613365 X:83659155-83659177 CAGGTAGGGGAAGAAAAGGCTGG + Intergenic
1195164316 X:102203160-102203182 CCTGTATGGGAAGCATAGCCTGG - Intergenic
1195194544 X:102483935-102483957 CCTGTATGGGAAGCATAGCCTGG + Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1195401884 X:104469487-104469509 GCTGCAGGGGAAGCAGAGTTTGG + Intergenic
1195692088 X:107635355-107635377 CCTGGAGGAGAATGAAAGTCAGG - Intronic
1196320200 X:114278536-114278558 CCTATAGAGTAGGCAAAGTCTGG - Intergenic
1197862392 X:130984672-130984694 CCTGCAGGGGAAGGGAAGGCTGG + Intergenic
1198296885 X:135295886-135295908 CCACTAGGGGAAGCGACGTCAGG + Exonic
1200150034 X:153946861-153946883 TGTGTAGGGGAAACAAAGGCAGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic