ID: 917639851

View in Genome Browser
Species Human (GRCh38)
Location 1:176972972-176972994
Sequence TCTGAAATGAGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 0, 2: 8, 3: 76, 4: 616}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917639851_917639860 21 Left 917639851 1:176972972-176972994 CCATCTTCCCTCCTCATTTCAGA 0: 1
1: 0
2: 8
3: 76
4: 616
Right 917639860 1:176973016-176973038 CAACACTTCTCCATAATTTTTGG 0: 1
1: 0
2: 0
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917639851 Original CRISPR TCTGAAATGAGGAGGGAAGA TGG (reversed) Intronic
900779946 1:4611572-4611594 CCCTAAAGGAGGAGGGAAGATGG + Intergenic
900882112 1:5389836-5389858 TCTGAACTGAGGAGGGACCCTGG + Intergenic
902729063 1:18356899-18356921 ACAGAAATGAGGAGAGAATAGGG + Intronic
902961758 1:19968581-19968603 TCTGAAATGAGTGGAGAGGAAGG + Intergenic
903020831 1:20392878-20392900 TCTGAAAGGTGGAGAGAAGAAGG + Intergenic
903042537 1:20542175-20542197 GGTGAAAGGAGGATGGAAGAAGG + Intergenic
903320229 1:22538728-22538750 TGTGAAATGGGGAGGGTAGGGGG + Intergenic
903570939 1:24304511-24304533 TCTGAAATGAGGTGGTGGGAAGG - Intergenic
903586013 1:24415799-24415821 TCTGAATTGGGAAGGGATGAAGG + Exonic
903854549 1:26328975-26328997 ACTGAGCTCAGGAGGGAAGAAGG - Intronic
904477765 1:30775829-30775851 GCTGAACTGAGGAGGGAGGGAGG + Intergenic
905084924 1:35364487-35364509 TCTAAAAGAAGGAGGGAAGGTGG - Intronic
905504507 1:38466407-38466429 TCAGAAAAGGGGAGAGAAGAGGG + Intergenic
906156205 1:43615431-43615453 TCTGATCAGAGGAGGGAAGCAGG - Intronic
906191317 1:43901209-43901231 TGTGAAAGGAGGATGGCAGAAGG - Intronic
906357806 1:45122527-45122549 TCTGAAAGGTGGAGGGCAGAAGG + Intronic
906850104 1:49238938-49238960 TCTGAAAGGTGGAGAAAAGAGGG - Intronic
907400835 1:54223793-54223815 ACTGAAATGAGGAGGAGAAAAGG - Intronic
907547363 1:55273917-55273939 TCTGAAAGGTGGAGTGAAGAAGG - Intergenic
907596822 1:55727771-55727793 TCAGAAGGGAGAAGGGAAGAAGG - Intergenic
907596937 1:55728678-55728700 TCAGAAGGGAGAAGGGAAGAAGG + Intergenic
907699083 1:56765785-56765807 TCTGAAAGGTAGAGAGAAGAAGG - Intronic
907763183 1:57382098-57382120 TCTCAACTGAGACGGGAAGAGGG - Intronic
908722897 1:67145494-67145516 CCAGAAAAGAGGTGGGAAGAGGG - Intronic
908833752 1:68208285-68208307 TCTGAAGAGAGGAGGGGAAAGGG - Intronic
909770118 1:79411629-79411651 TTGCAAATGAGAAGGGAAGATGG + Intergenic
910995673 1:93102046-93102068 TCTGAGATGAGGTGAGATGAGGG + Intronic
911101657 1:94100510-94100532 TCTCCAGTGAGTAGGGAAGAGGG + Intronic
911316471 1:96362155-96362177 GGGGAAGTGAGGAGGGAAGAAGG + Intergenic
911649234 1:100368737-100368759 ACTGAAGTGGGGAGGGAAGAAGG - Intronic
911910529 1:103628583-103628605 ACTGAAATGGAGAGGGATGAGGG + Intergenic
911917945 1:103722708-103722730 ACTGAAATGGAGAGGGATGAGGG + Intronic
912948275 1:114102820-114102842 TCTGAGCTGATGAGGGAAGGAGG + Intronic
913530177 1:119728396-119728418 TCTGAAATATGGAGGGAAACTGG - Intronic
914265112 1:146031915-146031937 ACTGAAATGTGGAGAGAAGGAGG - Intergenic
914408420 1:147400791-147400813 TCTGAAAGGTGGAGTGAAGAAGG - Intergenic
914804573 1:150982908-150982930 GCTGAAATGGTGAGGTAAGAGGG - Intronic
915594159 1:156887051-156887073 TCTGAAATCAGAAGGGATGTAGG + Intergenic
915839074 1:159201091-159201113 TTTGGAATGGGGAGGGAGGAGGG + Exonic
916802588 1:168228732-168228754 TCTGTGATGTGGAGAGAAGAGGG - Intronic
917639851 1:176972972-176972994 TCTGAAATGAGGAGGGAAGATGG - Intronic
918076700 1:181176110-181176132 GCGGGAATGTGGAGGGAAGATGG + Intergenic
918570655 1:185987936-185987958 GCTGAAATTAAGAGGGAAGAGGG + Intronic
919010594 1:191956847-191956869 TTTAAAAGGAGGAGGAAAGAGGG + Intergenic
919982019 1:202647660-202647682 TCTGAAGTGGGGAGGGAACTCGG - Intronic
920084959 1:203408684-203408706 GCTGATGTGGGGAGGGAAGAAGG + Intergenic
920269284 1:204751285-204751307 ACTGAAATCAGGAGAGAACAAGG - Intergenic
920699918 1:208210136-208210158 GGTGAAATGGGGAGGTAAGAAGG - Intronic
921392049 1:214626297-214626319 TTTGAAAGGTGGAGAGAAGAAGG - Intronic
921657405 1:217757206-217757228 TCTGAAATCAGGCAGGAAAAAGG - Intronic
922730586 1:227947064-227947086 TCAGAGAGGGGGAGGGAAGAAGG + Intronic
922856663 1:228780882-228780904 CCTGGAAAGAGGAGGGAAGGTGG + Intergenic
923699700 1:236288178-236288200 TCAGAAAGGAGCAGGCAAGATGG + Intergenic
923709421 1:236374294-236374316 TCTCAAAGAAGGAGGGAAGGAGG - Intronic
924046996 1:240042026-240042048 TCTTACAAGAGGAGGGAAGAGGG - Intronic
924323438 1:242872034-242872056 TCTGAAAGAAGGAGAGATGAAGG + Intergenic
924866829 1:247991908-247991930 TCTGAGGAGAGGAGGCAAGAAGG + Intronic
924869308 1:248023801-248023823 TCTGAGGAGAGGAGGCAAGAAGG + Intronic
1062866694 10:861721-861743 TCTGTCTTGAGGATGGAAGATGG - Intronic
1063266684 10:4459074-4459096 TCTGGACTGAGAAGGGAAGATGG - Intergenic
1063338687 10:5242619-5242641 TCTGAAATGTTGAGAAAAGAAGG + Intergenic
1064151709 10:12871125-12871147 TGGAAAATGAGGAAGGAAGAAGG + Intergenic
1064227846 10:13503323-13503345 GCTGAAAGGAAGAGGGCAGAAGG + Intronic
1064534958 10:16349313-16349335 TTCAAGATGAGGAGGGAAGAGGG - Intergenic
1065073451 10:22051787-22051809 TCTGCAATGTGGAGAAAAGATGG + Intergenic
1066227205 10:33394837-33394859 TGTGAAATGAGTAGGTAAGTAGG + Intergenic
1068431840 10:56943109-56943131 TCAGAAATGAAGAGGAAAGATGG - Intergenic
1068656285 10:59579265-59579287 TCTGAAAGGTGGAGAGAAGAAGG - Intergenic
1068827682 10:61457317-61457339 GGTGGAATGAGGAAGGAAGAAGG - Intergenic
1069075298 10:64032621-64032643 TTTGAAATGATGAGCTAAGACGG + Intergenic
1069667665 10:70174371-70174393 TCAGAAAGGAGGAGGGAGGAAGG - Intergenic
1070098811 10:73365625-73365647 GCTGGGAAGAGGAGGGAAGAGGG + Intergenic
1070194674 10:74146205-74146227 TATGGAAGGTGGAGGGAAGAGGG + Intronic
1070281690 10:75053643-75053665 TCAGAGTTGAGGAGGGGAGAGGG - Intronic
1071133096 10:82418455-82418477 AATGAAAAGAGGAGGTAAGAAGG + Intronic
1071197171 10:83175220-83175242 TTTGAAAAGGGTAGGGAAGAGGG - Intergenic
1071206072 10:83279993-83280015 TCTGAAAGTAGGAGAGTAGAAGG + Intergenic
1071472654 10:85994744-85994766 TCAGAAAAGAGTAGGTAAGATGG + Intronic
1072153864 10:92706158-92706180 ATGGAAATGAGGAGAGAAGAGGG - Intergenic
1072262688 10:93696140-93696162 TCTAAAAGGTGGAAGGAAGAAGG + Intronic
1074816349 10:117143709-117143731 TCTGAAATAAAAAGTGAAGATGG - Intergenic
1075448524 10:122530613-122530635 TCTGAAATGAGCAGTTAAGCTGG + Intergenic
1075700298 10:124464957-124464979 TCTGATGTGTGGAGGGGAGAGGG + Intronic
1075906662 10:126087585-126087607 TCTCAAATGAAGAGTTAAGATGG + Intronic
1076116718 10:127906591-127906613 TCTGGAAAGAGGAGGGGATAAGG - Intergenic
1076198554 10:128539837-128539859 TCTGAAATGAGCAAGGCAGCTGG + Intergenic
1076207327 10:128613498-128613520 GCTGAAAGGAGCAGTGAAGATGG + Intergenic
1076427658 10:130379197-130379219 TGTGAGCTGAGGAGGGAAGGAGG - Intergenic
1078741721 11:14072928-14072950 TATGAGATGAGCTGGGAAGATGG - Intronic
1078892027 11:15566243-15566265 TCTGAAATATGGAGGAGAGAAGG + Intergenic
1078963878 11:16313933-16313955 GCAGAAATGAGGAAGGAAGGGGG - Intronic
1079770871 11:24457891-24457913 TCTGAAAAGTGGAGAGAAGAAGG - Intergenic
1080515624 11:33016655-33016677 CATGAAATTAGGAGGGAAGTTGG + Intronic
1081284181 11:41247022-41247044 GCTGTAATGAGAAGGTAAGAAGG - Intronic
1081643558 11:44774633-44774655 AGGGAAATAAGGAGGGAAGAAGG - Intronic
1081677339 11:44978209-44978231 TGTGGAGTGAGGAGGAAAGAGGG + Intergenic
1082798870 11:57398980-57399002 GCTACAATGAGGTGGGAAGAGGG - Intronic
1082990794 11:59205729-59205751 TCTAGAATGAGTTGGGAAGAAGG - Exonic
1083096556 11:60256842-60256864 TCTGAAGGAAGGAGGGTAGACGG - Intergenic
1083289389 11:61681220-61681242 ACTGGACTGAGGAGGGCAGAAGG + Intronic
1085420499 11:76354262-76354284 TCTGATTTGAGGAGGGGTGAAGG - Intronic
1085509743 11:77082243-77082265 ACTGGCAGGAGGAGGGAAGAGGG + Intronic
1085572066 11:77568524-77568546 TGTGGAAAGGGGAGGGAAGAGGG - Intronic
1085653451 11:78290155-78290177 TCTGCAATGGTGAGAGAAGATGG + Intronic
1086208151 11:84285212-84285234 GCAGATTTGAGGAGGGAAGAAGG - Intronic
1086360532 11:86054373-86054395 TCTAAAATGAAGACGGAGGATGG + Intronic
1086543051 11:87935396-87935418 TCTGAAATGAGAAAGGATGGGGG - Intergenic
1086595714 11:88568096-88568118 TCTGAAATTAGAAAGGTAGATGG - Intronic
1086662820 11:89442856-89442878 TCTGAAAAGAGAAGAAAAGAAGG + Intronic
1087362780 11:97181824-97181846 ACTGAAACAAGGAGGGAACAAGG - Intergenic
1087515090 11:99149296-99149318 TCTGAAAAAAGAAGGAAAGAAGG + Intronic
1088046167 11:105454434-105454456 TATGAAAATAGGAGGGAAAAAGG + Intergenic
1088601169 11:111477597-111477619 TCTGAAAGGTGTAGAGAAGAAGG + Intronic
1089111367 11:116060461-116060483 TCTGAACTAGGGAGGGAGGAAGG + Intergenic
1089424210 11:118357707-118357729 TCTGAAATGGGTAGTGATGATGG - Intergenic
1089523500 11:119081385-119081407 TCTTAAATGAGGAGGTGATAAGG - Intronic
1089614428 11:119687255-119687277 TCTGGCGTGAGGAAGGAAGAGGG - Intronic
1089721602 11:120429031-120429053 TGTGAAACAAGGAGGGATGATGG + Intronic
1090035633 11:123247134-123247156 TGTGAGATGAGCAGGGAGGAAGG + Intergenic
1090440772 11:126723749-126723771 TATGAAAAGAGAAGGGAAGAAGG + Intronic
1090617222 11:128526136-128526158 GCTGCAGTCAGGAGGGAAGAAGG + Intronic
1091624994 12:2115054-2115076 TGTGAGATGCTGAGGGAAGAGGG - Intronic
1093002781 12:14016823-14016845 TCTGAAGTGAGAAGAGAATAGGG + Intergenic
1093428126 12:19052398-19052420 ACTGATAGGAGGAGGGATGAGGG - Intergenic
1093451169 12:19316410-19316432 TCTGAAATGGGAAGGGCTGAGGG + Intronic
1093531144 12:20165399-20165421 TGTGCAATAAGGAGGGAGGAAGG - Intergenic
1093867083 12:24240594-24240616 ACTGATTTGAGGAGGGAAAAGGG - Intergenic
1093949601 12:25150013-25150035 TCAGAAATGAAGGGGGAAGGTGG + Intronic
1094123122 12:26994969-26994991 TCTGAAATGTGAATGGAAGGAGG - Intronic
1095106134 12:38235093-38235115 TCGAAAATGAGTAAGGAAGATGG - Intergenic
1095581963 12:43810525-43810547 TCTGCAATCTGGTGGGAAGATGG + Intergenic
1096181606 12:49554275-49554297 TCAGCCATGAGGAGAGAAGAGGG - Intronic
1096449104 12:51722168-51722190 TCAGAAACAAGGAGGGAAGATGG - Intronic
1096775310 12:53960078-53960100 TCTGAATAGAGGAGGGTAGGAGG + Intergenic
1096985689 12:55755180-55755202 TCTGATATGAGGAGTGAGGGAGG - Exonic
1098508010 12:71277510-71277532 TGTAAAATGAGGGTGGAAGAAGG + Intronic
1098676197 12:73293076-73293098 TATAAAAAGAGGAGGGAACATGG + Intergenic
1098863329 12:75733826-75733848 ACTAAAGTGAGAAGGGAAGAGGG - Intergenic
1099205956 12:79727076-79727098 TATGAAAAGTGGAGGGAAGAAGG + Intergenic
1099215925 12:79853402-79853424 TCTGAAAGGTGGAGAGAATAAGG - Intronic
1099478445 12:83137695-83137717 TCAGAATTGATGAGGGATGAGGG + Intergenic
1099770063 12:87040938-87040960 AGTGAAATAAGGAGGGCAGATGG + Intergenic
1101442836 12:104716265-104716287 TCTGAAATGACAAGGGATGGGGG - Intronic
1102122611 12:110454261-110454283 TCTGCAAAGTGGAGGGAAAAGGG - Intronic
1103016093 12:117495673-117495695 TCAGAAGTGGGGAGGGAAAAAGG + Intronic
1103546911 12:121708742-121708764 TCTTAATTGAGGACTGAAGAGGG - Intergenic
1103976024 12:124703282-124703304 TCTGAGAGCAGGAGGGAAGCTGG + Intergenic
1104075086 12:125381615-125381637 TCTGAAATCAGGTGGGCTGAGGG + Intronic
1104139108 12:125969702-125969724 TCAGAAATGTGGAGAGAAGAAGG + Intergenic
1104140881 12:125984574-125984596 TCTGAAATGTGGAGATTAGAAGG - Intergenic
1104634352 12:130428222-130428244 TCTGAAATGCAGCTGGAAGATGG - Exonic
1105964681 13:25373194-25373216 TTTGACATGAGGAAGGTAGAGGG + Intronic
1107192056 13:37600921-37600943 CATGAAATGAGTAGTGAAGATGG + Intergenic
1107258998 13:38468119-38468141 TCTGAAAGGTAGAGAGAAGATGG - Intergenic
1107571644 13:41666399-41666421 TCAGAAATGAGGCAGTAAGATGG - Intronic
1107839508 13:44441212-44441234 TCTGCAATGGTAAGGGAAGATGG + Intronic
1108070109 13:46619662-46619684 TTTGAAATCAGAAGGGAAGGTGG + Intronic
1108520541 13:51243491-51243513 TCTGAAAGCAGGAGGGAAAAAGG - Intronic
1108965920 13:56301872-56301894 TCTGAAGATAGGAGGGTAGATGG - Intergenic
1109216694 13:59597644-59597666 ACTGAAAGGTGGAGAGAAGAGGG + Intergenic
1109415272 13:62031371-62031393 TCAGAAATGAGGAGGCATCAAGG - Intergenic
1110306530 13:73994087-73994109 TTAGCAATGAGGATGGAAGAAGG + Intronic
1110373123 13:74761822-74761844 TTTAAAGTGAGGGGGGAAGAGGG + Intergenic
1110862682 13:80360043-80360065 TCGGAGGTGAGGAGTGAAGAAGG + Intergenic
1110987721 13:81992950-81992972 TCACATATGAGGGGGGAAGAGGG + Intergenic
1111322982 13:86654786-86654808 TCTGAGATGAGGATGGATGTGGG - Intergenic
1112294066 13:98171088-98171110 TCTGGAAGCAGGATGGAAGAAGG + Intronic
1112829787 13:103435117-103435139 TTTGAAATCAGTAGGGAAAAGGG - Intergenic
1113363564 13:109654591-109654613 TCTGAAATGAGGAAGAAAGAAGG + Intergenic
1115122113 14:29949993-29950015 TCAGTAATGAAGAGGGAATAGGG + Intronic
1115152884 14:30305706-30305728 TGAGAAAGGAGGAGGGAAAAGGG - Intergenic
1115383933 14:32773590-32773612 TTTGAAATTATGATGGAAGAAGG + Intronic
1117407514 14:55418618-55418640 TCGGAAATGAGTAGGTCAGAGGG - Intronic
1117582629 14:57168318-57168340 ACTGACAGGAGGAGGGAAGTTGG + Intergenic
1118081847 14:62370059-62370081 AGTGGAATGAGGTGGGAAGATGG + Intergenic
1118355422 14:65009612-65009634 TCTGTAAAGAGGATGGAGGAGGG - Intronic
1118971411 14:70641643-70641665 TCTGAAAGGAGGTGGGGGGAGGG - Intergenic
1119604437 14:76002445-76002467 TGTTAGATGAGGAGGGAAGGAGG + Intronic
1119678845 14:76576684-76576706 ACTGAAAGGAGCAGGGAACAGGG + Intergenic
1119684528 14:76620799-76620821 TTTGAAATGGGGAGGGGTGAAGG + Intergenic
1120924668 14:89785646-89785668 CATGAAATGACGTGGGAAGAAGG + Intergenic
1121098199 14:91232721-91232743 TGTGGAATGAGGAGGCATGAAGG + Exonic
1121445367 14:93975308-93975330 ACTGGAATGAGGAGGCAAGGAGG - Intronic
1121515722 14:94548601-94548623 TCTGAACTGAGGAGAGAGGGAGG - Intergenic
1121998418 14:98625392-98625414 GCAGAAGTGGGGAGGGAAGAAGG - Intergenic
1122006197 14:98705875-98705897 TGTGAAATGGGGAGGGCAGCAGG + Intergenic
1122491777 14:102122114-102122136 TTTGGAGTGAGGAGGGAAGTAGG + Intronic
1122781480 14:104145679-104145701 TATGAGCTGGGGAGGGAAGATGG - Intronic
1123662197 15:22574317-22574339 TCTGCAATGAGAAGGTGAGATGG + Intergenic
1123842867 15:24267122-24267144 TCTGAAAGGAGGAGGGTTGGAGG - Intergenic
1123857904 15:24433148-24433170 TCTGAAAGGAGGAGGGTTGGAGG - Intergenic
1123862537 15:24483693-24483715 TCTGAAAGGAGGAGGGTTGGAGG - Intergenic
1124069726 15:26380072-26380094 TGTGAAGTGAGCTGGGAAGAGGG - Intergenic
1125325933 15:38535883-38535905 TCAGAAGTCAGGAGGGAAGTTGG + Intronic
1125332347 15:38594629-38594651 TATGACTTGAGGAAGGAAGAGGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126004648 15:44244648-44244670 ACTGTATGGAGGAGGGAAGAGGG + Intergenic
1126972242 15:54129065-54129087 TCTGAAAATTGGAGAGAAGACGG - Intronic
1128055425 15:64695894-64695916 TCTGAAGTGAGAAAGGAAGGGGG + Intronic
1128149930 15:65356293-65356315 TGGGAAAAGAAGAGGGAAGATGG + Intronic
1128400610 15:67276355-67276377 TCTGAAAGACGGAGAGAAGAAGG + Intronic
1129202829 15:74015238-74015260 TCTGAAACCAGGAGAGGAGATGG - Intronic
1129451946 15:75656102-75656124 GCTGGGATGAGGAGGGAACAGGG + Intronic
1129657410 15:77533481-77533503 AAAGCAATGAGGAGGGAAGAGGG + Intergenic
1129922774 15:79334416-79334438 TCTGAAATGAGGAAAAGAGAAGG - Intronic
1130392845 15:83473997-83474019 TCTGAAAGGTGGAGAGAAGAAGG - Intronic
1130412030 15:83655070-83655092 GCTGAAACCAGGAGGGAAGCGGG - Intronic
1130441095 15:83955246-83955268 TGTGGAAAGGGGAGGGAAGAGGG - Intronic
1130716675 15:86341443-86341465 TCTGAAAAGTGAAGAGAAGAAGG - Intronic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131647867 15:94364936-94364958 TCTGGAAGAAGGAGGAAAGACGG - Intronic
1131923658 15:97357985-97358007 TTTGAAATCAGGAGAAAAGAGGG - Intergenic
1133373404 16:5263541-5263563 AGTGAAATGAGGAGTGAAGGTGG + Intergenic
1133493607 16:6295730-6295752 CCTGAAATGAGGAGGGGACAGGG + Intronic
1133920615 16:10149733-10149755 TCTGGAGTGAGGAGGGGATAGGG - Intronic
1134402617 16:13924012-13924034 TCAGAAAGGAGGAGGGAATTTGG - Intronic
1135167310 16:20150739-20150761 TCTGAAATGAGAAATGATGAAGG + Intergenic
1136062357 16:27735298-27735320 TCTGGACTGGGGAAGGAAGATGG + Intronic
1137388998 16:48066103-48066125 TCAGAACTGAGGTGGGAAGAGGG - Intergenic
1137880120 16:52037312-52037334 TCTGAAATGTGGAGAAATGATGG + Intronic
1138508802 16:57495424-57495446 TCTGAAAGATGGAGAGAAGAAGG - Intergenic
1138915361 16:61456704-61456726 TCTGAAATCTGGAAGGAAAATGG - Intergenic
1139970808 16:70773546-70773568 ACTGCACTGAGGAGGGAAGAGGG + Intronic
1140646573 16:77038085-77038107 TTTGGAAGGGGGAGGGAAGAAGG - Intergenic
1141250898 16:82358241-82358263 TGTGCAATGTGGAGGGAAGCAGG + Intergenic
1141358003 16:83366773-83366795 TCTGAAATGGGGAGCACAGAAGG + Intronic
1141782076 16:86169241-86169263 TGAGAAGTGAGGAGGGAAGATGG + Intergenic
1141793996 16:86257224-86257246 TCTGAAATGTGGATTGGAGACGG - Intergenic
1142251409 16:88993663-88993685 GGGGAAAGGAGGAGGGAAGAGGG - Intergenic
1142288180 16:89179984-89180006 CCTGAAATGAGGCTGCAAGACGG + Intronic
1142497042 17:311410-311432 TCTGAAAGGCTGAGGGCAGAGGG - Intronic
1143288051 17:5805908-5805930 TCTGAAAGGTGGAGAGAAGAAGG - Intronic
1143327286 17:6107711-6107733 TGTGGAATGAGGTGGGATGAGGG + Intronic
1144250032 17:13407128-13407150 TCTGAATTGATGAGGAAAGCAGG - Intergenic
1144337569 17:14285431-14285453 TATGGAAGGTGGAGGGAAGAAGG + Intergenic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1144615636 17:16768951-16768973 TCTGAACTCAGAAGGGAAGGAGG - Intronic
1144806829 17:17973248-17973270 TATGAAAGGAGGCTGGAAGACGG - Intronic
1144897068 17:18546716-18546738 TCTGAACTCAGAAGGGAAGGAGG + Intergenic
1145015931 17:19398170-19398192 TCTGAAAGGTGGAGAAAAGAAGG - Intergenic
1145118597 17:20235070-20235092 TGTTAAAAGAGGTGGGAAGAGGG + Intronic
1146651346 17:34608658-34608680 TCTGAGAGGAGGAGACAAGAAGG - Intronic
1147947230 17:44086904-44086926 TCTGAGATGGGGAGGGATGGGGG + Intronic
1148225571 17:45896079-45896101 TCGGAAATGAGGAGCGAAAAAGG - Intronic
1148467550 17:47873948-47873970 GAGGAAAGGAGGAGGGAAGAGGG - Intergenic
1148745251 17:49914405-49914427 TCCTTAATGGGGAGGGAAGATGG - Intergenic
1149175778 17:53868354-53868376 TCTAAAAGGAGGAGAGAAGGAGG + Intergenic
1149220076 17:54406901-54406923 ACAGAAATGATGAAGGAAGAAGG - Intergenic
1152155269 17:78628936-78628958 TTTGAAATGAAGGGGGCAGAGGG - Intergenic
1152564347 17:81093449-81093471 TCTGAGATGATGGGGGAGGAGGG + Intronic
1152900723 17:82939567-82939589 TCTGATAGGAGGAGGAAAGAGGG + Intronic
1153174238 18:2352547-2352569 TCGGAAAAGTGTAGGGAAGAGGG + Intergenic
1153201780 18:2655237-2655259 TAAGAAATGAGGAGGAAAAAGGG + Intergenic
1154061437 18:11064387-11064409 TGGTAAAAGAGGAGGGAAGAAGG - Intronic
1155304247 18:24463686-24463708 TCTGAAACCTGGGGGGAAGAGGG - Intronic
1155562973 18:27100253-27100275 TCTAGAGTGAGGAGGGAGGATGG + Intronic
1156276635 18:35589633-35589655 TCTTAACTGTGGAGAGAAGAAGG - Intronic
1156981556 18:43295013-43295035 AAGGAAAGGAGGAGGGAAGAAGG + Intergenic
1157240379 18:46003731-46003753 TCTGAAAGGGGGAGAGAAGAAGG - Intronic
1157560865 18:48645146-48645168 TCGGAGAGGTGGAGGGAAGAAGG + Intronic
1157977245 18:52340923-52340945 AATGAAATGAGAAGGGAAGTGGG - Intronic
1158086787 18:53660946-53660968 ACTAATATGAGAAGGGAAGAAGG - Intergenic
1158199504 18:54924311-54924333 TCTGAACAGCGGAGAGAAGAAGG + Intronic
1158548400 18:58414999-58415021 TCTGAAGGGAGGGGGGAAGGAGG - Intergenic
1158685365 18:59609183-59609205 TGTGCAGTGAGAAGGGAAGATGG - Intronic
1159274681 18:66201498-66201520 TCTAAAAAGAAGAGGTAAGAAGG - Intergenic
1159382227 18:67675079-67675101 TAAGAAATGAGGTTGGAAGATGG - Intergenic
1159776392 18:72607760-72607782 TCTGAATTGAAAAGGAAAGAAGG - Intronic
1160172834 18:76568717-76568739 TTTCAAATGAGGAGGGGAGTGGG + Intergenic
1160379011 18:78435794-78435816 TCTGAATTCAGGAGTTAAGATGG - Intergenic
1161671822 19:5616475-5616497 TCTGTAATTAGGACTGAAGATGG - Exonic
1163290508 19:16376568-16376590 TCTGATGTGAGGAGGCAGGATGG - Intronic
1163433952 19:17284033-17284055 TCTGAGATGGGGAGGAAAGTGGG - Intronic
1164783414 19:30911497-30911519 TCTGGAAAAAGGAAGGAAGAAGG + Intergenic
1165117389 19:33537120-33537142 TCTGAAATGACGTGTGAACAGGG - Intergenic
1165976196 19:39678930-39678952 TCAGAAAGGAGGATGGTAGAAGG - Intergenic
1166648523 19:44552078-44552100 TCGGAAAGGAGGAGAGAATATGG + Intergenic
1166681605 19:44771054-44771076 GCTAAAGTGGGGAGGGAAGAAGG - Intergenic
1166704037 19:44898469-44898491 ACAGAAATGAAGGGGGAAGAGGG - Intronic
1167587008 19:50380941-50380963 TCTGAGCGGAGGAGGGAAGTGGG - Intronic
1167782463 19:51608060-51608082 TCTCAAATGCAGAGGTAAGAAGG - Intergenic
1168436872 19:56325145-56325167 ATTGCAATGGGGAGGGAAGAAGG - Intronic
925073000 2:985983-986005 TCAGAAAGGAAGAGGGGAGAGGG + Intronic
925579807 2:5398817-5398839 TCTGAAAGGTGGGGAGAAGAAGG - Intergenic
925926424 2:8674285-8674307 TCTGAAAAGAGAAGAGAAAAAGG + Intergenic
925982741 2:9190511-9190533 CCTGAATTGATGAGGGATGAGGG + Intergenic
926688900 2:15719207-15719229 CAAGAAGTGAGGAGGGAAGACGG + Intronic
927812048 2:26185640-26185662 TCCAATATGAGGAGGGAAAAAGG - Intronic
928020172 2:27698372-27698394 TGTGAAAGAAGGATGGAAGACGG + Intergenic
928620480 2:33083292-33083314 TCTTGATTGAGGAGGAAAGAAGG + Intronic
929244761 2:39689337-39689359 TCTGAAATGGGGAGGGAAAAGGG - Intronic
929377289 2:41303361-41303383 GATGCAATGAGGAGAGAAGAGGG + Intergenic
929451843 2:42043181-42043203 TCTGAAAAGAGGGGGGAAAAGGG - Intergenic
929955930 2:46458697-46458719 ACTGAAATCTGGAGGGAGGAGGG + Intronic
930011982 2:46944309-46944331 ACTGAAATGTGGAAGGAAAAGGG - Intronic
930685694 2:54305983-54306005 TAAGAAATGAGGAGAGATGAAGG + Intergenic
931193843 2:60031023-60031045 TCTGAGATGAGAAGTGAAGCTGG + Intergenic
931917640 2:66975625-66975647 TCTGAAAAGACAAGGGAATAGGG + Intergenic
932293470 2:70604904-70604926 TCTAAAAGGGGGAGAGAAGAAGG - Intergenic
932621628 2:73268284-73268306 TCTGTAAGGAGGAGAGAAAAGGG + Intronic
932805247 2:74777687-74777709 TCTGAAACTATGTGGGAAGAGGG + Intergenic
933134459 2:78714954-78714976 TGGGAAATGAGTAGAGAAGAAGG - Intergenic
933327060 2:80851448-80851470 TATGAAATGAAGACAGAAGAGGG - Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933616159 2:84484273-84484295 TCTGAAATGTGGAGAGAAGATGG - Intergenic
934037587 2:88101135-88101157 GCTGGAAGAAGGAGGGAAGATGG + Intronic
934105641 2:88692137-88692159 TCTTTAAGGAGCAGGGAAGAGGG - Intronic
934573961 2:95389061-95389083 GCGGAAATAGGGAGGGAAGAGGG + Intergenic
934792076 2:97069997-97070019 GCTGAAAGAAGGAGGGAAGAGGG - Intergenic
934814543 2:97313713-97313735 GCTGAAAGAAGGAGGGAAGAGGG + Intergenic
934823150 2:97394770-97394792 GCTGAAAGAAGGAGGGAAGAGGG - Intergenic
935193498 2:100796759-100796781 TCTGAAATGAAGAAGACAGAAGG - Intergenic
935590764 2:104844089-104844111 TCTGAAGTGAGAAAGGAAGCTGG - Intergenic
935624225 2:105156015-105156037 TCTGAAAAGGGGAAGGAAGAAGG + Intergenic
936845236 2:116822758-116822780 GCTGAACTGAGGAGGAGAGAAGG - Intergenic
936920879 2:117687315-117687337 TCTGAAAGGTGGCGAGAAGAAGG + Intergenic
937402608 2:121597943-121597965 TCTCACCTGATGAGGGAAGAAGG + Intronic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
937521622 2:122719912-122719934 TGTAAAATGAGGTAGGAAGAAGG + Intergenic
937787113 2:125914031-125914053 TCTGAAATCAGAAGTGAAGTTGG - Intergenic
937824689 2:126355524-126355546 TCTGTAATGAAGAAGTAAGAAGG + Intergenic
937849047 2:126616759-126616781 TCTCAAATGTGGAGGGGAGGTGG + Intergenic
937883639 2:126886123-126886145 TCTGGGATGAGAAGGGAAGTGGG + Intergenic
938027337 2:127961466-127961488 TTTGAAATAAGCAGGGAAGTTGG - Intronic
938060917 2:128253611-128253633 TCTGAAAGGTGGAGAGAAGACGG + Intronic
938228723 2:129639554-129639576 TCTGAAAAGTGGAGAGAAGAAGG - Intergenic
938672565 2:133599838-133599860 TCAGAAATCAGGATGGGAGAGGG + Intergenic
938889594 2:135690813-135690835 TGTTAAAGGAGAAGGGAAGAGGG + Intronic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939664552 2:144934875-144934897 ACTGAAATGAGGAGAGGAGGAGG + Intergenic
939765106 2:146238599-146238621 GCAAAAATGAGGAGGGAGGAAGG + Intergenic
940610252 2:155981001-155981023 TTTGAAGTGAGGAGAGAAGGTGG + Intergenic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
941274001 2:163467266-163467288 TCTGAAATGTGGTTGGCAGAGGG + Intergenic
941399734 2:165015783-165015805 TCTAAAATGCTGAGGTAAGAAGG - Intergenic
942085783 2:172442420-172442442 TCTGAAAGGAGGATAGACGAAGG + Intronic
942196147 2:173522185-173522207 TCTGAGATGAGGCTTGAAGATGG + Intergenic
942199218 2:173554059-173554081 TCTGAAACGAGGAGGCTAGGGGG + Intergenic
943663164 2:190580473-190580495 TGTGAGATCAGCAGGGAAGACGG - Intergenic
944674701 2:202025583-202025605 GCTGTCAGGAGGAGGGAAGAAGG + Intergenic
945327677 2:208501542-208501564 TCAGAAAGGGGGAGGGAAGGAGG - Intronic
946259787 2:218478312-218478334 TCTGAATTGAGGAATTAAGATGG - Intronic
948557252 2:238821909-238821931 TCCCAAGTGAGGAGGGAGGAGGG - Intergenic
1168762566 20:359436-359458 TCTGAAATGATGTGGTGAGAAGG + Intronic
1168766340 20:383958-383980 CCTGCAATGAGGAGGGATGATGG - Intronic
1168901821 20:1371277-1371299 TAAGAAATGAGGGTGGAAGAGGG + Intronic
1169828144 20:9791987-9792009 TCTCAGATCAGGAGGGAAGAGGG - Intronic
1169923878 20:10762735-10762757 TATGAAATAAAGAGGGAGGAAGG - Intergenic
1170320087 20:15086388-15086410 TATGAACTAAGTAGGGAAGAAGG + Intronic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1171273434 20:23834560-23834582 TATGAAAAGAGGATGGAAGCTGG + Intergenic
1172122427 20:32606335-32606357 TCTGGGATGAGGAGGGTTGAGGG - Intronic
1172637932 20:36422526-36422548 TTTGGACTGAGGTGGGAAGAAGG + Intronic
1173045499 20:39505522-39505544 TCTGACAGGAGGAGAGAAGAAGG + Intergenic
1173556348 20:43968714-43968736 GCTGTAATGAGGACTGAAGATGG + Intronic
1173872231 20:46349293-46349315 TCTCAAATGAGGAAGGGAGGGGG - Intronic
1174127408 20:48317217-48317239 TCTGAACAGTGGAGAGAAGAAGG + Intergenic
1174286816 20:49480001-49480023 GCTGAAATGGGGAGGGAGGCAGG - Intronic
1174339603 20:49887606-49887628 TCAGAAAGGAGGAGGGAGCATGG - Intronic
1175119937 20:56709667-56709689 TCTAAGAAGAGGAGGGCAGAAGG - Intergenic
1175496760 20:59419879-59419901 TCCGAATTGAGGAGGGCAGTAGG + Intergenic
1175766172 20:61594278-61594300 GCTGAGCTGAGCAGGGAAGAAGG + Intronic
1175857418 20:62129763-62129785 CCTGAATTGAGGAGGGGAGGAGG - Exonic
1175870673 20:62208128-62208150 ACTGGACTGAGGAGGGAACAAGG - Intergenic
1176876685 21:14136483-14136505 TTTGGAAAGGGGAGGGAAGAGGG + Intronic
1176975870 21:15321185-15321207 GCTGAAAAGAAGAGGGGAGAGGG - Intergenic
1177013971 21:15761292-15761314 TCAGACATGAGCAGGGCAGAAGG + Intronic
1177287221 21:19067043-19067065 TCTGAAACGTGGAGAGAAGTTGG - Intergenic
1177750944 21:25283245-25283267 TTTGCAAAGAGGAGGGGAGATGG + Intergenic
1178662893 21:34521804-34521826 TCTGTAATGGGGAGGGCAAAAGG + Intronic
1178817200 21:35942299-35942321 TGTGTAATGAGGAGGTAAGTTGG - Intronic
1178817216 21:35942542-35942564 TGTGTAATGAGGAGGTAAGTAGG - Intronic
1179032402 21:37732023-37732045 TCTTAGATGAGGAAGGGAGATGG + Intronic
1179097422 21:38328132-38328154 ACTGAAATGAGGAGTCAGGAAGG - Intergenic
1180133389 21:45843134-45843156 CCTGAAAGCTGGAGGGAAGAAGG - Intronic
1180164618 21:46017731-46017753 TCTGAAAGGTGGAGCAAAGAAGG - Intergenic
1181481119 22:23199679-23199701 TCTGAAAGGAGAGGGGAAAATGG + Intronic
1181559239 22:23690442-23690464 GCTGAAATGAGGAGGGGATGAGG + Intronic
1181661764 22:24355711-24355733 ACTGAAGTGAGTAGGGAAAAAGG - Intronic
1181793825 22:25288789-25288811 TCAAAAATGAGCAGGGCAGATGG - Intergenic
1181833822 22:25585335-25585357 TCAAAAATGAGCAGGGCAGATGG - Intronic
1181901921 22:26163204-26163226 TGTGTCAGGAGGAGGGAAGAAGG - Intergenic
1182251586 22:29005007-29005029 TCTGAAAAGCGGAGACAAGAGGG - Intronic
1182719245 22:32384366-32384388 TCTAAAATGAGGAGGGGACGAGG + Intergenic
1182897086 22:33867952-33867974 TCTTGAATGAGGAGGGAATTGGG - Intronic
1183089516 22:35511730-35511752 ACGGAAATGAGGAGGAAAGTGGG + Intergenic
1183511730 22:38239366-38239388 ACTGAAATGAGAAGGAATGAGGG + Intronic
1184342129 22:43891851-43891873 TCTTAGAGGAGGAGGGCAGATGG - Exonic
1184564940 22:45286145-45286167 TCTGCAGGGAGGAGGGAAGGAGG + Intronic
1185169440 22:49284114-49284136 CCAGGAATGAGGAGGGAGGAAGG + Intergenic
949184056 3:1169083-1169105 TATGAAATGAGGAAGAAGGAAGG + Intronic
949360045 3:3221978-3222000 AGTGAAATGAGGGGAGAAGAAGG - Intergenic
950028243 3:9835066-9835088 TGTGAAAGGAGGGGAGAAGAGGG - Exonic
950185386 3:10942041-10942063 TCAGACATGAGGAGGGAAGATGG - Intergenic
950247164 3:11431549-11431571 GCTGGAAGGAGGAGGGAACAGGG - Intronic
950330880 3:12155251-12155273 TTAGAAATGAGTAGGGTAGATGG + Intronic
950624099 3:14231636-14231658 TCAGAGATGAGGAGGGAGGGTGG - Intergenic
950836872 3:15928746-15928768 TATGAAATGAGGAAGAAAAATGG + Intergenic
951941579 3:28085201-28085223 TCTAGAATGAGGAAGAAAGAAGG - Intergenic
952022782 3:29042537-29042559 TCTGAAAAATGGAAGGAAGAAGG - Intergenic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
952710668 3:36429207-36429229 TGTGAAATGAGGAAGTAAGCTGG + Intronic
952955760 3:38556291-38556313 GCTGGAATGAGGTGGGGAGAAGG - Intronic
953506476 3:43490761-43490783 TCAGGCATGAGGAGGGCAGAAGG + Intronic
954167524 3:48772093-48772115 TCTGAAAGGTGGAAAGAAGAAGG - Intronic
954489255 3:50886147-50886169 TCTGAAAGGCGGAAAGAAGAAGG - Intronic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
955830195 3:62993197-62993219 TCTGAAAAATGGAGAGAAGAAGG - Intergenic
956057789 3:65318869-65318891 TCTGAAGGGAGGAACGAAGAAGG + Intergenic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
959770372 3:110088070-110088092 TTTGAAATCAGCAGGGAAAATGG + Intergenic
960029481 3:113042860-113042882 TCTGAAAGGAGAAAGGAAGGAGG - Intergenic
960031126 3:113055991-113056013 TGTGAAAAGAGAAGGGAAGACGG + Intergenic
962745383 3:138394201-138394223 TGTGAAATGAAGAGGTCAGAAGG - Intronic
962768252 3:138587201-138587223 TCTGAAATGAAGATTAAAGAAGG + Intronic
963254888 3:143134881-143134903 TATGATATTAGGAGGGATGAAGG + Intergenic
963357867 3:144232818-144232840 TGTAAGATGAGGTGGGAAGAGGG + Intergenic
963383556 3:144561262-144561284 TCTGAAAAGGGGAGGGTAAAGGG - Intergenic
963689193 3:148477389-148477411 TATGGAATCTGGAGGGAAGAGGG + Intergenic
965553378 3:169993747-169993769 AATGAAATGGGGAGGGAGGAGGG - Exonic
967094738 3:186168055-186168077 GTTGAAAAGAGGAAGGAAGAAGG + Intronic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
967492766 3:190112547-190112569 TCTGAAAAGAAGAGAGCAGAGGG - Intronic
968539236 4:1154798-1154820 TCTGGAAAGAAGTGGGAAGATGG + Intergenic
969065702 4:4478820-4478842 TCTGAAAAGAGGAGAGGACAGGG - Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
970173574 4:13313551-13313573 TCTGAATTGTGGAGAGAAGAAGG + Intergenic
970442501 4:16093752-16093774 TCTGAGAGCAGGAAGGAAGAGGG + Intergenic
970606392 4:17686005-17686027 TCTGAAATAAGGTGGTAAGCTGG - Intronic
970963212 4:21897855-21897877 ACTGAATACAGGAGGGAAGACGG + Intronic
971058947 4:22945061-22945083 TCTGGAATTAGAAGAGAAGAAGG - Intergenic
971615170 4:28779848-28779870 TCTCAAATAGGTAGGGAAGAAGG - Intergenic
972368055 4:38394406-38394428 TCTGAAGAGAGGAGAGGAGAAGG - Intergenic
972688026 4:41369763-41369785 GCTGAAACAAGGAGGGAACAGGG - Intronic
972954617 4:44373835-44373857 TCTGAAATGAGAATGAAAGAGGG - Intronic
973630070 4:52811949-52811971 TTTAAAATGAGGAGAGAAGAGGG + Intergenic
973794745 4:54413188-54413210 TCTGAATGGTGGAGAGAAGAAGG - Intergenic
974372247 4:61032595-61032617 TCTGCAGTGCTGAGGGAAGAAGG - Intergenic
974379190 4:61116698-61116720 AGTAAAATGAGGAGGGGAGAGGG + Intergenic
974755070 4:66194357-66194379 TCTGAAAGTTGGAGAGAAGAAGG - Intergenic
975692912 4:76983420-76983442 TCTGGAATGAGCTTGGAAGAGGG + Intronic
975726811 4:77300477-77300499 TTTGAAAAGATGAGAGAAGAAGG - Intronic
975922839 4:79413510-79413532 TTTGAAAGGAGGTGGGAAAAGGG + Intergenic
976025859 4:80687671-80687693 TCTGGAGGGAGGAGGCAAGATGG + Intronic
976339960 4:83935730-83935752 TCTGTGATGAGGAAGGAAGGAGG + Intergenic
976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG + Intergenic
976447673 4:85150514-85150536 TCAGAAATGTGGAGGGAAAAGGG + Intergenic
978008599 4:103651319-103651341 TTTGAAATGAAGACGGAAGAGGG - Intronic
978406494 4:108384883-108384905 TCTGAAAGGTGGAGACAAGAAGG + Intergenic
978931697 4:114321947-114321969 TCCGAAATAAGGAGAGAACAAGG + Intergenic
980272865 4:130609338-130609360 TCTGACCTGAGGAGGTAAAATGG + Intergenic
981517089 4:145621040-145621062 TCTGAAAGGAGGACTGAGGAGGG + Intronic
981562598 4:146063931-146063953 AAGGAAATGAGGAAGGAAGAAGG - Intergenic
981884172 4:149652651-149652673 CCAGAAATGAAGAGAGAAGATGG + Intergenic
982545746 4:156731180-156731202 TCTGAAAGGTGAAGAGAAGAAGG + Intergenic
982637323 4:157913569-157913591 TATGAACTGTGTAGGGAAGAGGG - Intergenic
982832384 4:160079457-160079479 GCTGAAAAGGGTAGGGAAGAGGG - Intergenic
983480916 4:168272497-168272519 TGTGAAAAGAGCAGGGAAGCAGG + Intronic
983990048 4:174107612-174107634 GCTTAAATCAGGAGAGAAGACGG + Intergenic
984194448 4:176642059-176642081 TCTGAAAAGTGGAGAAAAGAAGG + Intergenic
984237066 4:177172425-177172447 TCTAGAGGGAGGAGGGAAGAAGG - Intergenic
984309995 4:178045238-178045260 GTTGAAAGGAGGAGGAAAGATGG - Intergenic
984459965 4:180021969-180021991 TCTGAAGTGTGGACGAAAGAAGG + Intergenic
985128418 4:186718183-186718205 TTTAAGAGGAGGAGGGAAGATGG - Intronic
985802075 5:2011095-2011117 ATTGCAATGAGGAGGGAAGAAGG + Intergenic
985936148 5:3100096-3100118 TCTGAAATGAGCAGGGAGACAGG - Intergenic
985976030 5:3419790-3419812 TCTGGAATGCGGGTGGAAGAGGG + Intergenic
986252752 5:6075737-6075759 ATAGAAAGGAGGAGGGAAGAAGG - Intergenic
986408583 5:7452244-7452266 TCAGAAATGGGGAGGGCAGGAGG - Intronic
986619541 5:9658041-9658063 TCTGAAAGGTGGCGGGATGAAGG - Intronic
986714607 5:10513910-10513932 TCTCAGATGAGGAGGCATGAAGG + Intronic
986756378 5:10840137-10840159 TTTGGAAAGTGGAGGGAAGAAGG + Intergenic
987531375 5:19125438-19125460 TCTGAAATGATGAAGGGAAATGG - Intergenic
988298131 5:29391622-29391644 TCTGGAAGGAGGGTGGAAGAGGG - Intergenic
989255632 5:39363239-39363261 TATGGAAAGAGGAGGGATGAAGG + Intronic
989461156 5:41699919-41699941 ACTGAAAGGAGGAGTGTAGATGG - Intergenic
989740954 5:44771281-44771303 TCTAAAATACTGAGGGAAGAAGG + Intergenic
991420001 5:66431025-66431047 TCTGAAAGATGGAGAGAAGAAGG + Intergenic
992055398 5:72983993-72984015 TCTCAAATAAGGATGGAAGGTGG - Intronic
992255436 5:74916276-74916298 GATGAAGTGAGAAGGGAAGATGG + Intergenic
992716146 5:79513647-79513669 TCTGAAGAGAGGAGGGAAGAGGG - Exonic
992848963 5:80784684-80784706 TTTAAAATGTGGAGGGAAGTGGG - Intronic
993830955 5:92757231-92757253 TATAAAATGAGAAGGGAATATGG + Intergenic
994117280 5:96074704-96074726 TCTGAGATGGGGAAGAAAGAAGG + Intergenic
994412961 5:99432383-99432405 TCTGAACTCATGAAGGAAGAGGG + Intergenic
994480878 5:100333336-100333358 TCTGAACTCATGAAGGAAGAGGG - Intergenic
995541552 5:113190927-113190949 TCTGAAGTGGGCAAGGAAGATGG + Intronic
995694066 5:114860031-114860053 TCTAAAATGAGGTGGGGAGAAGG + Intergenic
996205863 5:120734271-120734293 ACAGGAGTGAGGAGGGAAGAGGG + Intergenic
996660970 5:126002419-126002441 TCTCAAACCAGGAGGGAAAAAGG + Intergenic
996973349 5:129399431-129399453 TCTGAAATAATATGGGAAGAGGG - Intergenic
997113698 5:131102779-131102801 TCAGAAGAGATGAGGGAAGAAGG + Intergenic
997257183 5:132438009-132438031 TCTGATATGAGGTGGAAACAGGG + Intronic
997430865 5:133840074-133840096 TCTGTAATGTGAAGGGTAGAAGG - Intergenic
997536338 5:134625084-134625106 TCTAAGATTAGGAGGAAAGATGG + Intronic
998878821 5:146626953-146626975 ATGGAAATGAGGATGGAAGAAGG + Intronic
999892284 5:155992214-155992236 TAAGAAAGGAGGAGGGAACAAGG - Intronic
1000330512 5:160201629-160201651 TGAGAAATGAGAAGGGGAGAGGG - Intronic
1000645597 5:163757024-163757046 TCAGAGAGGTGGAGGGAAGATGG - Intergenic
1001149512 5:169214951-169214973 TCAGTAATGCGGAGGGAAGATGG - Intronic
1001191558 5:169637238-169637260 TTTGAAAAGAGGAAGGAAGTGGG + Exonic
1001329226 5:170750625-170750647 TCAGAACAGAGCAGGGAAGAGGG - Intergenic
1001382409 5:171313214-171313236 TCAGAACTGGGGAGAGAAGAAGG - Intergenic
1001532071 5:172470243-172470265 TCTGGAAGGTGGAGAGAAGAAGG - Intergenic
1001761931 5:174214626-174214648 CCTGCATTGAGCAGGGAAGAAGG + Intronic
1001896152 5:175383216-175383238 TCTGAAAAGGGGAGAGAAGAAGG + Intergenic
1002035608 5:176467030-176467052 TCTGAAGGGAGGAGGAAGGAGGG + Intronic
1002614161 5:180440151-180440173 TCTGGAAAGAGGAAGGAAGCTGG - Intergenic
1002716526 5:181231528-181231550 TGGGAAGGGAGGAGGGAAGAGGG - Intronic
1003058837 6:2846688-2846710 GGTGAAATGAGGGGGAAAGAAGG - Intergenic
1003089420 6:3089025-3089047 TCTGAAAGGAGAAGAGAAGGAGG - Intronic
1003634815 6:7822448-7822470 GCAGGCATGAGGAGGGAAGAGGG - Intronic
1003702317 6:8481372-8481394 ACTGAAATGTGGAAAGAAGAAGG - Intergenic
1003914233 6:10770869-10770891 GCTGAAATGAGGGAGGATGAGGG + Intronic
1004126738 6:12881576-12881598 GATGAAATGGAGAGGGAAGAGGG - Intronic
1004430802 6:15541039-15541061 TCTGAAATGAAGTGGGGAGCTGG - Intronic
1004737456 6:18421842-18421864 TCTGGAATGAAAAGGGATGAGGG + Intronic
1005510782 6:26509802-26509824 ACTGAGATGAGCAGGGATGAAGG + Exonic
1005607999 6:27495014-27495036 TCTGAACGGAGGAGAGGAGAGGG - Intergenic
1005906271 6:30263529-30263551 TCTGAAATTAGCAGAGAAGAGGG + Intergenic
1005929207 6:30469208-30469230 CCTCAAAGGAGGAGTGAAGATGG + Intergenic
1006976767 6:38109635-38109657 CCAGAAATGGGAAGGGAAGATGG + Intronic
1007038038 6:38695987-38696009 TCTGAAAGGTGGTGAGAAGAAGG - Intronic
1007208117 6:40169376-40169398 TCTGAAGTGAGAATGGAACATGG + Intergenic
1007297956 6:40842376-40842398 TCTGAAATGAGGAGAAAAGAAGG - Intergenic
1007325413 6:41055649-41055671 TCCGACATGAGGAGGGTAGCTGG + Intronic
1008124012 6:47648652-47648674 TCTGAATGGAGGAGGGGAAAAGG - Intergenic
1008494289 6:52116982-52117004 TCAGAAATAAGCTGGGAAGATGG + Intergenic
1008519916 6:52353243-52353265 TCAGAAATGTGGAGGGATCAGGG + Intergenic
1008790104 6:55220739-55220761 ACTGAAATCAGCAAGGAAGAGGG + Intronic
1008799376 6:55347396-55347418 TCTGAATTAAGGGTGGAAGATGG + Intronic
1009390775 6:63140628-63140650 TTTGGAAAGAGAAGGGAAGAGGG + Intergenic
1010063344 6:71650433-71650455 TCTGAAATGTGAAGAAAAGAAGG - Intergenic
1010114966 6:72293857-72293879 ATTGAATTGAGGTGGGAAGAAGG + Intronic
1010132992 6:72517238-72517260 TTTGAAAAGTGGAGGAAAGAAGG - Intergenic
1011252197 6:85383591-85383613 TGTGAAAGAATGAGGGAAGAGGG - Intergenic
1011603497 6:89081055-89081077 TAGGAAATGAGGGAGGAAGAGGG - Exonic
1012066916 6:94559665-94559687 ACGAAAATGTGGAGGGAAGAAGG + Intergenic
1012073711 6:94657241-94657263 TGTGGAAAGAGGAGAGAAGAGGG - Intergenic
1012867096 6:104631760-104631782 TCTGAAAGCAGGAAGGCAGATGG + Intergenic
1013426839 6:110019653-110019675 GCTGAACTCAGGAGGGAGGATGG + Intergenic
1013908608 6:115246997-115247019 TGTGGAAAGGGGAGGGAAGAGGG + Intergenic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014167119 6:118238028-118238050 TCTAAGATGAGAAAGGAAGAGGG - Intronic
1014192453 6:118513233-118513255 TCTCTAAAGAGGAGGTAAGAAGG + Intronic
1014202887 6:118624394-118624416 GTAGAAAGGAGGAGGGAAGAAGG - Intronic
1014683392 6:124463599-124463621 TTGGAAGGGAGGAGGGAAGAAGG - Intronic
1014719898 6:124903624-124903646 TCTGAAAGTGGGAGAGAAGATGG + Intergenic
1015374059 6:132490453-132490475 TATGCCTTGAGGAGGGAAGAAGG - Intronic
1016151265 6:140745539-140745561 TTTGAAAACGGGAGGGAAGAGGG + Intergenic
1016689662 6:146922461-146922483 TCTAAAATGAGGACTGCAGAAGG + Intergenic
1016787547 6:148028779-148028801 TCTGAAATGTGGACAGAAGAAGG + Intergenic
1017716669 6:157218049-157218071 GCTGGAAAGAGGAGGCAAGAAGG + Intergenic
1018062684 6:160102991-160103013 TATGATGTGAGGAGGGCAGAGGG - Intronic
1018179195 6:161205959-161205981 TCTGAAAGGTGGAGAGAAGAAGG + Intronic
1018680867 6:166263676-166263698 TCTGAGATAAGGAGGGATGAGGG - Intergenic
1019010357 6:168839769-168839791 TCTGAGATGGGGAGTGGAGAGGG + Intergenic
1019010370 6:168839815-168839837 TCTGAGATGGGGAGTGGAGAGGG + Intergenic
1019957397 7:4426087-4426109 TCTGAAAGGGGGAGAGAAGAAGG - Intergenic
1020075642 7:5256656-5256678 TCTGGAATGTGGAGGGGAGGAGG + Intergenic
1020080216 7:5282789-5282811 GGTGAAGGGAGGAGGGAAGAGGG + Intronic
1021416130 7:20387213-20387235 TTATAAATGAGGAGGGAAAAAGG + Intronic
1021775824 7:24054509-24054531 TCTGTAAGAAGGAAGGAAGAAGG + Intergenic
1021909461 7:25369788-25369810 TCTGGAATCAGAAGGGAAGAAGG + Intergenic
1022402619 7:30054714-30054736 GGTGAAATAAGGAAGGAAGATGG + Exonic
1022595265 7:31707533-31707555 TCCTAAATGAGGAGGTAACAGGG + Exonic
1022903722 7:34835492-34835514 TCTGAAAAGAGGAGGGCTTAGGG - Intronic
1023281761 7:38577825-38577847 AAGGAAAGGAGGAGGGAAGACGG + Intronic
1023522156 7:41059552-41059574 GCTGAGATGAGGAGGGACAAAGG - Intergenic
1023656890 7:42432277-42432299 TCTGAAATGAAAGAGGAAGAAGG + Intergenic
1023834105 7:44058467-44058489 ACCGAAATGAGCAGGTAAGATGG + Exonic
1023925313 7:44664649-44664671 TCTGAAAGGTGGAGAGAATAAGG - Intronic
1024474849 7:49799194-49799216 TCTGAGATGGTGAGGCAAGAAGG + Intronic
1024636229 7:51292710-51292732 TCTGGAGTGTGGAGGGAGGAGGG - Intronic
1025108498 7:56193032-56193054 TTTGGGATGAGCAGGGAAGATGG + Intergenic
1025203432 7:56976891-56976913 TCTGGAATGTGGAGGGGAGGAGG - Intergenic
1025668512 7:63600036-63600058 TCTGGAATGTGGAGGGGAGGAGG + Intergenic
1027772166 7:82420309-82420331 TCTGAATTTAGGAGAGATGAAGG + Intronic
1028865294 7:95703813-95703835 AATGAAATAAGAAGGGAAGATGG - Intergenic
1029241345 7:99165366-99165388 CCTGAGCTGAGGAGGAAAGAGGG + Intergenic
1029374039 7:100167289-100167311 AGGGAAATGAGGGGGGAAGAAGG + Intronic
1029406780 7:100379985-100380007 CCTGAAAGTAGGAGTGAAGATGG + Intronic
1029539717 7:101175466-101175488 TCTGAAAGCTGGTGGGAAGAGGG - Intronic
1030093298 7:105876585-105876607 TCTGAAAGGGGGAGGGAGGGAGG + Exonic
1030150105 7:106395801-106395823 TCTGGAATGAGGTGGAAAGGAGG + Intergenic
1031084597 7:117289998-117290020 TCTGAGATGAGGAGGGCTGGGGG + Intronic
1031786799 7:126043599-126043621 TATGAAATAAAGAGGGAAAAGGG - Intergenic
1032068819 7:128791598-128791620 TCTGGAAGGAGGAGGGATGGAGG - Intronic
1032534247 7:132648557-132648579 GCTGGATTGAGGAGGGAACATGG - Intronic
1033003901 7:137539134-137539156 CCTAAAATTAGGAGGGAAGAGGG + Intronic
1033684412 7:143625295-143625317 ACTGAAATCAGGAAGGAAGAAGG - Intronic
1033687588 7:143704514-143704536 ACTGAAATCAGGAAGGAAGAAGG - Intronic
1033700199 7:143832328-143832350 ACTGAAATCAGGAAGGAAGAAGG + Intergenic
1033975812 7:147099192-147099214 TCTGGGATGAATAGGGAAGACGG + Intronic
1034671000 7:152858465-152858487 CCTAAATTGAGGAGGGAAGAAGG + Intergenic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1034775969 7:153827433-153827455 TCTGAAAGAAGGAGGGAAGAAGG + Intergenic
1034851132 7:154495064-154495086 TCTGGTATGAGGAGGGAGCAGGG + Intronic
1035062606 7:156080132-156080154 TCTGACACAAGGAGGGAAGAAGG - Intergenic
1035081583 7:156220611-156220633 TTTGAGAGGAGCAGGGAAGAGGG - Intergenic
1036004088 8:4642335-4642357 TCAGAAATGATGAGGGCACAGGG - Intronic
1036133116 8:6134714-6134736 CATGAAATGAGAAGGGAAGAGGG + Intergenic
1036170710 8:6481555-6481577 TGGGAGAGGAGGAGGGAAGACGG - Intronic
1036182654 8:6598426-6598448 TCAGACATGAGGGGAGAAGAAGG + Intronic
1037449612 8:19003622-19003644 TTTTAAAAGAGGAGGGAAGAAGG + Intronic
1038019447 8:23540783-23540805 TCTGAAATAAGGAGGGGTAACGG + Intronic
1038169122 8:25112833-25112855 CTTGAAATGAGGAGGGAAACAGG - Intergenic
1039842128 8:41301604-41301626 TCTTAAGTGAGGAGGGCAGGTGG + Intronic
1040079906 8:43275488-43275510 TCAGACCCGAGGAGGGAAGAAGG - Intergenic
1041777965 8:61545037-61545059 TCTGGAATGAGGATGGTAAAGGG + Intronic
1041829873 8:62142471-62142493 TCTGTAATGAGGAAGGAAGCTGG - Intergenic
1041864932 8:62561256-62561278 TCTAAAAAGTGGAGAGAAGATGG - Intronic
1042455660 8:68999518-68999540 TCTGAAAGGTAGAGAGAAGAAGG - Intergenic
1042527168 8:69775140-69775162 TCACAAATGAGAGGGGAAGAGGG + Intronic
1042846039 8:73170420-73170442 TGTGATATGAGGAAGGAGGAAGG - Intergenic
1043524779 8:81084148-81084170 TCTGAAAGGTAGAGGAAAGATGG - Intronic
1043569300 8:81584345-81584367 TCTGATCTGAGTGGGGAAGATGG - Intergenic
1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG + Intergenic
1043912102 8:85875231-85875253 ATTGCAATGAGGAGGGTAGAGGG - Intergenic
1044684940 8:94817437-94817459 TCTGAAGAGAAGAGGGAAGGAGG - Intronic
1044872038 8:96628901-96628923 TTTGAAGGGAGGAGGGAGGAAGG - Intergenic
1044876146 8:96668718-96668740 TCTGAAAGGTGGAGAGAATAAGG + Intronic
1044943645 8:97369545-97369567 TCTGCCTTGAGGAGGCAAGAAGG + Intergenic
1045733374 8:105267220-105267242 TGTGGAAAGAAGAGGGAAGAGGG - Intronic
1046012484 8:108566059-108566081 TCTGAAAGATGGAGAGAAGATGG - Intergenic
1046454042 8:114436089-114436111 TCTGAAATATGGAAAGAAGAAGG + Intergenic
1047043323 8:121023088-121023110 TCTGAAAATAGGAGCAAAGAGGG - Intergenic
1047219050 8:122903982-122904004 CCTGAAAAGTGGAAGGAAGAAGG + Intronic
1047433752 8:124817027-124817049 CCTTAAATGATGAGGGAATATGG + Intergenic
1048644771 8:136407971-136407993 TTTGAAATAAGGTGGGAAAATGG + Intergenic
1049281657 8:141752673-141752695 ACGGAAATGAGGAGGGTAGCTGG + Intergenic
1049321887 8:142001097-142001119 TAAGAAATGACAAGGGAAGAAGG + Intergenic
1049331249 8:142054934-142054956 CCTGAAAGGTTGAGGGAAGAAGG - Intergenic
1049582207 8:143417966-143417988 TCTGGAGAGAAGAGGGAAGAGGG + Intergenic
1050236138 9:3582235-3582257 TCTGAAGTGGGGAGGGTAAAGGG + Intergenic
1050389070 9:5118288-5118310 TTTGGAATGAGAAGGGAAGTGGG - Intronic
1050907396 9:11022355-11022377 TATTTAATGAGGAGGGCAGAAGG - Intergenic
1052152850 9:25140452-25140474 ACTGAGAAGGGGAGGGAAGAGGG + Intergenic
1052658299 9:31393964-31393986 TCTGAAATGAGTAGGTAGCAAGG - Intergenic
1053342453 9:37349126-37349148 AATTGAATGAGGAGGGAAGAAGG + Intronic
1054850548 9:69842817-69842839 TCAGATGTGAGGAGAGAAGAGGG + Intronic
1054924424 9:70575182-70575204 TTTAAAATGAGGAGGGAGGATGG - Intronic
1055003058 9:71475146-71475168 TCTGAAAGGTGAAGGGAAGAAGG - Intergenic
1055229424 9:74043850-74043872 TCTGAAATGAGGGACCAAGAAGG + Intergenic
1055704718 9:78985122-78985144 TCTGAAAGCAGCAGGGGAGAGGG + Intergenic
1056046568 9:82724146-82724168 TATGAAATCAGAAGGGAGGAGGG + Intergenic
1056104392 9:83332705-83332727 TCAGAAAGCAGGAAGGAAGAAGG + Intronic
1056797823 9:89670678-89670700 TCAGACATGTGGAGGGTAGATGG + Intergenic
1056806583 9:89733499-89733521 AAGGAAATGAAGAGGGAAGAAGG - Intergenic
1057085906 9:92209797-92209819 TCTGACATGAGGAGTGTAGTTGG + Intergenic
1057704732 9:97388599-97388621 TCTGAAAAGTGGAGGGATGATGG - Intergenic
1057876072 9:98755496-98755518 GCGGGAATGATGAGGGAAGATGG - Intronic
1058001621 9:99871657-99871679 TCAGAATGGTGGAGGGAAGAGGG - Intergenic
1058453826 9:105120930-105120952 TCTGGAGTGAGTAGGGAAGAGGG + Intergenic
1058601353 9:106674238-106674260 TCTGAACAGAGGAGGGAAGGGGG - Intergenic
1058967958 9:110054515-110054537 TCTGTAATGAAGATGAAAGAAGG - Intronic
1061401942 9:130373312-130373334 TCTGTAGTGAGGTGGGGAGAGGG - Intronic
1061430661 9:130528313-130528335 CCTGAGATGAGGAGGGAAGGTGG + Intergenic
1061458262 9:130714385-130714407 TATCAAAGGAGCAGGGAAGAAGG + Exonic
1061825020 9:133252549-133252571 AGTGAAATGTGGAGGGAGGAAGG + Intronic
1186357562 X:8803160-8803182 TTTAAAATGTTGAGGGAAGAAGG - Intergenic
1186467722 X:9797119-9797141 TCTGAGAGGAGGAGGCAACAAGG - Intronic
1186589357 X:10913504-10913526 TCTGAAAGGTGGAGAAAAGAAGG - Intergenic
1186617931 X:11208981-11209003 TTTAAAATGTTGAGGGAAGAAGG + Intronic
1186977142 X:14919655-14919677 ACTGAGCTGAAGAGGGAAGAGGG - Exonic
1187047178 X:15658449-15658471 TCTCAAGGGAGGAGTGAAGAAGG + Intronic
1187190127 X:17026608-17026630 TATGGAATGAGGAGGGAATGGGG - Intronic
1187573192 X:20526581-20526603 TCTTAAATGAGGAGGGATCTTGG - Intergenic
1187700427 X:21959915-21959937 CCTGAAAGGAGCAGGCAAGAAGG + Intronic
1187737996 X:22323926-22323948 TCTGAAAGGAAAAGGGAACATGG - Intergenic
1187741773 X:22363802-22363824 CTTGAAATGAGGACGGAAGGGGG + Intergenic
1187990257 X:24863266-24863288 TTTGAAAAGAGGGTGGAAGATGG - Intronic
1188205907 X:27358313-27358335 TCTGAAAGGTGAAGAGAAGAAGG + Intergenic
1188357630 X:29212163-29212185 TGTGAAATGAGGAGAGAAGTCGG - Intronic
1188627688 X:32306725-32306747 ACTGAAAGGAGGAGGAAGGAAGG - Intronic
1188990679 X:36816010-36816032 TCTGAAAGGTGGAGAGAATAAGG + Intergenic
1189339762 X:40195922-40195944 AGTGAAATGAGGAGGTATGAGGG + Intergenic
1189798864 X:44673525-44673547 TCTGAAATGAGGGGATAAAAAGG - Intergenic
1189991063 X:46595727-46595749 TCTGAAGGGTGGAGAGAAGAAGG - Intronic
1190981268 X:55458363-55458385 GGTGAAATGTGGGGGGAAGAAGG + Intergenic
1190987430 X:55514817-55514839 GGTGAAATGTGGGGGGAAGAAGG - Intergenic
1191104223 X:56762477-56762499 TCTGAAAGGAGCAGAGATGAAGG + Intergenic
1192133535 X:68575304-68575326 GCTGAGATGGGGAGGGCAGAGGG + Intergenic
1192188715 X:68977511-68977533 TCTGAAAAGTGGAGAGAAGAAGG - Intergenic
1193201608 X:78697948-78697970 ACTAAAAGGAAGAGGGAAGATGG + Intergenic
1193505706 X:82340929-82340951 TCTGAAAGTAGGAGAGAAGAAGG + Intergenic
1194323189 X:92477632-92477654 GGAGAAATGAGGAGGGAAAAGGG - Intronic
1194816636 X:98449452-98449474 TATGAAAGGAGGAAGAAAGAAGG + Intergenic
1195115826 X:101696774-101696796 TGTGGAAAGGGGAGGGAAGAGGG + Intergenic
1195641787 X:107183492-107183514 TCTGAAAGGTAGAGAGAAGAAGG + Intronic
1196217543 X:113071590-113071612 TGTGGAAAGAGAAGGGAAGATGG - Intergenic
1196293474 X:113972134-113972156 TCGGAAATGTGGAGGGCAGAAGG - Intergenic
1196320957 X:114339819-114339841 GCTGAAATGAGGGGGGAAATAGG - Intergenic
1196994600 X:121368023-121368045 TCAAAAATGAGGGGGGAAAAGGG + Intergenic
1197250273 X:124208903-124208925 TGTGGAAAGAGGAAGGAAGAGGG + Intronic
1198719785 X:139603908-139603930 TATGAAATGAGAAGAGAATAAGG - Intronic
1199059985 X:143343996-143344018 TCTGAAATGATGTGACAAGAAGG + Intergenic
1199243708 X:145577851-145577873 TCTGAAATCATTAGGAAAGAGGG - Intergenic
1200397380 X:155999137-155999159 CCTGTGATGGGGAGGGAAGATGG + Intronic
1200631290 Y:5590791-5590813 TGAGAAATGAGGAGGGAAAAGGG - Intronic
1200957043 Y:8960123-8960145 TTTAAAATGAGGAAAGAAGAAGG + Intergenic