ID: 917644361

View in Genome Browser
Species Human (GRCh38)
Location 1:177015575-177015597
Sequence CTACAATTCCACATTTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917644360_917644361 -10 Left 917644360 1:177015562-177015584 CCAGAAGAATCATCTACAATTCC 0: 1
1: 0
2: 0
3: 18
4: 157
Right 917644361 1:177015575-177015597 CTACAATTCCACATTTATTTAGG 0: 1
1: 0
2: 3
3: 33
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917644361 Original CRISPR CTACAATTCCACATTTATTT AGG Intronic
902814681 1:18909465-18909487 CTACAATTCCAGATGCAATTTGG - Intronic
904714852 1:32459795-32459817 CTACAATTCAACATGAAATTTGG + Intergenic
904966163 1:34375414-34375436 CTTCAATTCATCATTTAATTGGG + Intergenic
905021738 1:34820519-34820541 CTACAATTCTCCACTTATTAAGG + Intronic
906663540 1:47599919-47599941 CTGCAGTTCCTCATATATTTAGG - Intergenic
906833356 1:49058231-49058253 CTACAATTCCAGATGAAATTTGG - Intronic
907055652 1:51365213-51365235 TCACAATTTTACATTTATTTAGG + Intronic
908304495 1:62798228-62798250 CTAGAATTCATCATTTATTGAGG + Intronic
909195819 1:72621795-72621817 CTATATTTCTCCATTTATTTAGG + Intergenic
909551468 1:76902534-76902556 CTGCAATTCCATATGAATTTTGG - Intronic
910378883 1:86603846-86603868 CTACAATTCAAGATGTAATTTGG + Intergenic
910461874 1:87456252-87456274 CTAAATTTCCATATGTATTTTGG + Intergenic
911506150 1:98754496-98754518 CTACAAATTCAAATTCATTTGGG + Intronic
911651212 1:100391053-100391075 CTTGAATTCCACAGTTATATAGG + Intronic
911970182 1:104424520-104424542 TTGCAATTCAACATTTCTTTAGG - Intergenic
912177843 1:107182706-107182728 CTACAATCACACATTCAATTGGG + Intronic
914358147 1:146906190-146906212 CTAAATTTCCATATGTATTTTGG + Intergenic
914495274 1:148190818-148190840 CTAAATTTCCATATGTATTTTGG - Intergenic
914979795 1:152403729-152403751 TTTCCATTGCACATTTATTTTGG - Intergenic
915707338 1:157857941-157857963 GTATAACTCCCCATTTATTTAGG - Intronic
916212650 1:162371357-162371379 ATACAATTACACAGTTATATTGG - Intronic
917644361 1:177015575-177015597 CTACAATTCCACATTTATTTAGG + Intronic
918026269 1:180750883-180750905 ATACACTTCTGCATTTATTTAGG + Intronic
918385146 1:183998703-183998725 CTATGTCTCCACATTTATTTTGG + Intronic
918857144 1:189771143-189771165 CTTCATTTCCACTTTTATTTGGG - Intergenic
918929028 1:190829456-190829478 CAACAATTCCATAATTATTGTGG + Intergenic
919009664 1:191944213-191944235 CTATAATTTCACACTTGTTTTGG + Intergenic
919138823 1:193544513-193544535 TTCCAAATCCACAGTTATTTAGG + Intergenic
919493305 1:198232906-198232928 GTACAATTGCACATATTTTTAGG + Intronic
919545539 1:198913173-198913195 GTACAAGTCCACTTATATTTAGG - Intergenic
921984860 1:221301637-221301659 ATATAATTACTCATTTATTTGGG + Intergenic
923261834 1:232275180-232275202 CTACAATTCGACATGTGATTTGG - Intergenic
923465505 1:234244728-234244750 TTTCAATTCCACATTTATACTGG + Intronic
924792263 1:247262820-247262842 TTACAATTCCACATGAAATTTGG - Intergenic
1063310336 10:4946059-4946081 CTACAATTTCACATGTGATTTGG - Intronic
1063316964 10:5016090-5016112 CTAGAATTTCACATGTAATTTGG + Intronic
1063679700 10:8175189-8175211 CAACAACTTCACATTCATTTTGG + Intergenic
1063808650 10:9678310-9678332 CAAGAATTCTACATTTATATTGG + Intergenic
1063957185 10:11278054-11278076 CTAAAATGCCACATTTATATGGG + Intronic
1064848158 10:19679651-19679673 CTTCAATTCCACCTTGATCTTGG + Intronic
1065317508 10:24478166-24478188 CTAACATCCCACAGTTATTTGGG - Intronic
1065493309 10:26304531-26304553 CCACATTTACACATTTATTTGGG - Exonic
1065494767 10:26316735-26316757 CAACAAGTACACACTTATTTGGG + Intergenic
1066355273 10:34677536-34677558 CATCAATTCTACACTTATTTTGG - Intronic
1067271444 10:44794975-44794997 CCACACTTTCACATTTATTATGG + Intergenic
1068282226 10:54888626-54888648 CTAAAATTACACAATTTTTTTGG - Intronic
1068357745 10:55932052-55932074 CTACATTTACACATCAATTTAGG - Intergenic
1068610418 10:59053853-59053875 CTACAATTCAAGATTTAAGTGGG + Intergenic
1068687093 10:59881496-59881518 CTAAAATTTCAGATTCATTTTGG + Intronic
1068975468 10:63004124-63004146 CTACAATTCGACATGCAATTTGG + Intergenic
1069254635 10:66317320-66317342 ACATAATTCCTCATTTATTTGGG + Intronic
1072646726 10:97261561-97261583 ATACAATTTTACAGTTATTTTGG - Intronic
1073192293 10:101660295-101660317 CTACAATTACACACTTGCTTGGG + Intronic
1073200350 10:101730280-101730302 CTACAATTCAAGATTAAATTTGG + Intergenic
1073836815 10:107453722-107453744 CTTCAATACCATTTTTATTTTGG - Intergenic
1075770891 10:124934385-124934407 ATACAATTTCACACTAATTTAGG + Intergenic
1076548410 10:131261240-131261262 CTTAGATACCACATTTATTTGGG - Intronic
1077855356 11:6118722-6118744 CTTCATTTCCACTTTGATTTTGG - Intergenic
1078230612 11:9438665-9438687 GTATGATCCCACATTTATTTGGG - Intronic
1078236854 11:9492979-9493001 ATATAATTCCACATTTTTTCTGG - Intronic
1078286545 11:9961166-9961188 ATACATTTTCTCATTTATTTAGG + Intronic
1078385275 11:10885545-10885567 CAGAAATTCAACATTTATTTGGG + Intergenic
1078589459 11:12626944-12626966 CTAAAATACCATATTAATTTAGG + Intergenic
1078688424 11:13554688-13554710 CTACAATTCGAGATTTAGGTGGG + Intergenic
1078756194 11:14212952-14212974 CTACACTTCCACATTTTGCTTGG - Intronic
1078960909 11:16269219-16269241 CTAAACTTCCACACATATTTGGG + Intronic
1079298857 11:19259359-19259381 AGACATTTTCACATTTATTTAGG + Intergenic
1079438498 11:20483706-20483728 TTACAATTCTCCATTTATGTTGG - Intronic
1079631919 11:22688039-22688061 TTACAATTACAAATCTATTTGGG - Intronic
1079869899 11:25784028-25784050 CAAAAATTCAACATATATTTGGG + Intergenic
1081415058 11:42804581-42804603 CTGCAAAACCTCATTTATTTGGG + Intergenic
1084104545 11:66972701-66972723 CTACAATTCAACATGAAGTTTGG - Intergenic
1086408410 11:86519639-86519661 CCACCATTCCACATATTTTTTGG + Intronic
1086700026 11:89891027-89891049 ATAAAACTCCAAATTTATTTAGG + Intergenic
1086706144 11:89953489-89953511 ATAAAACTCCAAATTTATTTAGG - Intergenic
1086839007 11:91661290-91661312 TTATAATTTCACATTTATTAGGG + Intergenic
1086902109 11:92379531-92379553 CTACAATCCAACAGTGATTTTGG - Intronic
1087114400 11:94509182-94509204 ATACATTTCTGCATTTATTTAGG + Intergenic
1087365278 11:97210836-97210858 GTACATTTCTTCATTTATTTTGG + Intergenic
1087799523 11:102488622-102488644 TTACCCTTCCAGATTTATTTTGG - Intronic
1088184563 11:107150967-107150989 CTACAAATTCATAATTATTTTGG - Intergenic
1088641148 11:111874135-111874157 CAAATATTCCACATTAATTTTGG - Exonic
1089899479 11:121965740-121965762 TTACAATTCCACATTTTCTCTGG - Intergenic
1090313662 11:125765756-125765778 CTCTGATTCCTCATTTATTTGGG + Intergenic
1090683273 11:129085465-129085487 CAACATTTCTCCATTTATTTAGG - Intronic
1090978951 11:131699847-131699869 CTACAATTCAAGATAGATTTGGG + Intronic
1092708714 12:11311323-11311345 CTACAATTCTACATTCAAATAGG + Intergenic
1093266466 12:17008963-17008985 GTATAACTCCCCATTTATTTAGG + Intergenic
1093384465 12:18534516-18534538 TAACAATTTGACATTTATTTGGG - Intronic
1093767977 12:22986695-22986717 ACAGAATTCCACATTTATTAAGG + Intergenic
1094129851 12:27063173-27063195 TTACAAGTTTACATTTATTTTGG - Intronic
1094344842 12:29456042-29456064 CTAGTATTCCAATTTTATTTTGG + Intronic
1095344253 12:41130883-41130905 CTACAATTCAACATAACTTTTGG - Intergenic
1095739455 12:45591289-45591311 ATAGAATACCATATTTATTTTGG - Intergenic
1096790143 12:54039372-54039394 CTAAGACTCCCCATTTATTTGGG - Intronic
1097390121 12:59000902-59000924 GTATAATTCACCATTTATTTAGG - Intergenic
1097392563 12:59033547-59033569 CTACAATTCAAGATGAATTTTGG - Intergenic
1098026889 12:66213320-66213342 CTACAATTCAAGATGAATTTGGG + Intronic
1098441822 12:70527363-70527385 ATACAATTTCACATATATTCTGG + Intronic
1099111454 12:78567160-78567182 CGACAATTCCACATAGATATGGG - Intergenic
1099360602 12:81695262-81695284 CTACAATTCCACATAAAAGTAGG - Intronic
1099578963 12:84417398-84417420 CTATAATTCCACATATTTTCTGG - Intergenic
1099581539 12:84453445-84453467 CTATAATTCAACATTAGTTTAGG - Intergenic
1100294558 12:93248669-93248691 CTAAAATTCCACCATTATTAAGG + Intergenic
1100724706 12:97396361-97396383 GTACAATTCCACATTATATTTGG + Intergenic
1101575203 12:105990903-105990925 TTCCAATTGCACATTTATGTGGG - Intergenic
1102288485 12:111679499-111679521 CTTCAGTTCAACATTTATTACGG + Intronic
1103104562 12:118211919-118211941 CAACAATTCCATGTTTCTTTAGG - Intronic
1105257069 13:18750809-18750831 TTACAATTCCACATGAGTTTTGG + Intergenic
1105258377 13:18760317-18760339 TTACAATTCCACATGAGTTTTGG + Intergenic
1105263347 13:18796208-18796230 TTACAATTCCACATGAGTTTTGG + Intergenic
1106976779 13:35227466-35227488 CTACATTTCCTCATTTACATAGG + Intronic
1107102023 13:36603423-36603445 CTACATTCCCATGTTTATTTCGG + Intergenic
1107152369 13:37126947-37126969 ATACAAATACACATTTATTGAGG - Intergenic
1107487970 13:40849203-40849225 CTACATTTCCATATAAATTTGGG - Intergenic
1107693502 13:42976822-42976844 CCACAATTACAATTTTATTTGGG + Intronic
1108627830 13:52248669-52248691 CTACATTTCCATATAAATTTGGG - Intergenic
1108658228 13:52557784-52557806 CTACATTTCCATATAAATTTGGG + Intergenic
1109092971 13:58072021-58072043 TTACAATTAAACATTTTTTTGGG - Intergenic
1109178159 13:59180920-59180942 CTACAAATACATTTTTATTTGGG - Intergenic
1109507712 13:63328440-63328462 CTACAATTCAACATAAAATTTGG - Intergenic
1109876003 13:68405341-68405363 CTACAATTCCAGATTAGATTTGG + Intergenic
1110041361 13:70763441-70763463 CTACATTTCTACATTTATTATGG - Intergenic
1110648275 13:77915164-77915186 CTACGTTGCCACAATTATTTAGG + Intronic
1110720692 13:78758211-78758233 ATAGAATTTCTCATTTATTTTGG - Intergenic
1110792936 13:79605498-79605520 CTCCACTTCCACTTTTATGTGGG - Intergenic
1111063127 13:83050311-83050333 CTACTCTTGGACATTTATTTTGG + Intergenic
1111164390 13:84439192-84439214 CTTCATTTCCATATTTATTTAGG + Intergenic
1111303594 13:86376579-86376601 CTACATTCCCACGTTTATTGAGG + Intergenic
1111827336 13:93283925-93283947 TTACAATTTCACATTCCTTTTGG + Intronic
1112092920 13:96101429-96101451 CAATATTTCCGCATTTATTTTGG + Intronic
1115793379 14:36905018-36905040 CTAGAATTTAACAATTATTTTGG - Intronic
1116400569 14:44501319-44501341 ATATATATCCACATTTATTTAGG - Intergenic
1116706763 14:48312421-48312443 CTACAGCTCAAGATTTATTTCGG + Intergenic
1117752124 14:58935289-58935311 CTACAATTCAAGATGGATTTGGG + Intergenic
1119068954 14:71561311-71561333 CTATAATTCCATCTTTATATAGG + Intronic
1119459025 14:74782547-74782569 CTACAATACTACATTCATTCTGG - Intronic
1119514412 14:75236700-75236722 CTACTATTATACATTAATTTTGG - Intergenic
1120609521 14:86623147-86623169 CTACAATTCCAGATGAGTTTTGG - Intergenic
1120760260 14:88278497-88278519 CTTTCATTCCACATTAATTTAGG - Intronic
1120860463 14:89250698-89250720 CTACAATTCGAGATTTGTGTGGG - Intronic
1120963416 14:90146285-90146307 CTACCACTCCAGTTTTATTTTGG + Intronic
1121837401 14:97104374-97104396 CTACCTTTCCAAATTCATTTCGG + Intergenic
1122308817 14:100781939-100781961 CTACGATTCCACATATATGAGGG - Intergenic
1125113877 15:36065943-36065965 TTACTATTCCACTTTTCTTTTGG - Intergenic
1125295592 15:38199693-38199715 CTACAATTTCAAAGTTATTTCGG - Intergenic
1125494380 15:40177769-40177791 GTATAATTCTCCATTTATTTAGG + Intronic
1126336798 15:47593980-47594002 TTACAATTCCACATGAAATTTGG + Intronic
1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG + Intergenic
1126892554 15:53222131-53222153 CCACAGTGCCACATTTATGTAGG - Intergenic
1127926767 15:63553313-63553335 CCCCAATTCCCCATTAATTTGGG + Intronic
1128728187 15:70003109-70003131 CTAGGGTTCCACATTGATTTGGG + Intergenic
1128858953 15:71048647-71048669 CAAGAATTTAACATTTATTTTGG - Intronic
1129911659 15:79232803-79232825 CTGCAATTCTCTATTTATTTTGG - Intergenic
1131137320 15:89947714-89947736 ATTCAAATCCTCATTTATTTTGG - Intergenic
1131699729 15:94921352-94921374 TTACAATTCCACATGAAATTTGG + Intergenic
1133863623 16:9620507-9620529 ATACATTTCTACATTTATTTAGG - Intergenic
1134407555 16:13974906-13974928 TTACAATTTCAGATTTCTTTGGG - Intergenic
1136709757 16:32227318-32227340 CTACAATTCAAGATTAAATTTGG - Intergenic
1136758152 16:32702093-32702115 CTACAATTCAAGATTAAATTTGG + Intergenic
1136809955 16:33168282-33168304 CTACAATTCAAGATTAAATTTGG - Intergenic
1136816431 16:33278362-33278384 CTACAATTCAAGATTAAATTTGG - Intronic
1138154661 16:54692286-54692308 ATACATTTCTACATTTCTTTAGG + Intergenic
1138197775 16:55065703-55065725 ATATATTTCTACATTTATTTAGG - Intergenic
1139030261 16:62872273-62872295 CTACAATTTTATTTTTATTTTGG - Intergenic
1141031618 16:80594144-80594166 TTACAATTCGACATGGATTTGGG + Intergenic
1203060303 16_KI270728v1_random:962442-962464 CTACAATTCAAGATTAAATTTGG + Intergenic
1144436091 17:15242896-15242918 TTAAATTTCCAAATTTATTTTGG - Intronic
1145104851 17:20106497-20106519 CTAAAATTCAACATGAATTTTGG - Intronic
1146139754 17:30355456-30355478 CTTAAATTGCATATTTATTTAGG + Intergenic
1146752119 17:35391204-35391226 TGACAAGTCCACATTTATTCAGG - Intergenic
1149310228 17:55386151-55386173 CTACAATTCCACATGAGATTTGG - Intergenic
1149388584 17:56167507-56167529 CTACAAACCCAGATTTAATTGGG - Intronic
1149729158 17:58927495-58927517 CTAAGATTCCACAATTTTTTTGG - Intronic
1149879253 17:60271703-60271725 CTACAATTCCCCATTTAAGTAGG + Intronic
1153718779 18:7880172-7880194 CTACAATTCAAGATGTAATTTGG + Intronic
1154059881 18:11049566-11049588 CTACAATTCAAGATTTGATTTGG - Intronic
1154424985 18:14265189-14265211 TTACAATTCCACATGAGTTTTGG - Intergenic
1154427708 18:14284576-14284598 TTACAATCCCACATGTGTTTTGG - Intergenic
1154428511 18:14290565-14290587 CTACAATTCCACATGAATATTGG - Intergenic
1154430791 18:14306988-14307010 CTACAATTCCACATGAATATTGG - Intergenic
1154433459 18:14326213-14326235 CTACAATTCCACATGAGTATTGG - Intergenic
1155767653 18:29654874-29654896 TTACAATTCAACATGAATTTGGG + Intergenic
1155911948 18:31514051-31514073 CTACGATTCCACATTGCATTTGG - Intronic
1159210248 18:65311401-65311423 CTTAGATTCCACAGTTATTTAGG - Intergenic
1159492956 18:69162492-69162514 TTACATTTACACATTTTTTTAGG + Intergenic
1159514801 18:69444840-69444862 TTACAATTCCATATGAATTTTGG + Intronic
1161882741 19:6968214-6968236 CACCACTTCCACATCTATTTGGG + Intergenic
1163983316 19:20922143-20922165 ATACATGTCCACATGTATTTCGG - Intergenic
1165135382 19:33665047-33665069 CTACACTCCCACGTTTATTGCGG - Intronic
1202637235 1_KI270706v1_random:52934-52956 CTACAATTCCACATGAACATTGG + Intergenic
925036069 2:686792-686814 TTACAATTCCACATGAAATTTGG - Intergenic
925654681 2:6133411-6133433 CTAGAATTCGACATTCATTTTGG + Intergenic
927314447 2:21665573-21665595 CTAAAAATCCAAAATTATTTGGG + Intergenic
927689623 2:25198883-25198905 CTAAATTTCCACATATACTTGGG - Intergenic
927910681 2:26896749-26896771 TTTCAATTCCTTATTTATTTTGG + Intronic
928565780 2:32547077-32547099 ATACAATTCCAGATTCATTTTGG + Intronic
928730379 2:34224976-34224998 CTCCTATTTCACATTTAATTTGG - Intergenic
929164815 2:38871135-38871157 TTAAAAATCCACATTTATATTGG + Intronic
929521240 2:42653165-42653187 ATACAATCACACATTTAGTTGGG + Intronic
930205487 2:48583500-48583522 TTATAGTACCACATTTATTTTGG + Intronic
930506305 2:52286123-52286145 TTACAATTCAACATAGATTTGGG + Intergenic
931032268 2:58190855-58190877 CTAAAATTCAACTTTTATTTTGG + Intronic
931151356 2:59577385-59577407 CTTTTATTCCACATGTATTTAGG - Intergenic
931806212 2:65808747-65808769 GTATAATTCTACATTTATTCAGG - Intergenic
933623084 2:84566826-84566848 ATACATTTCTACATGTATTTTGG - Intronic
933689818 2:85171288-85171310 CTACAATTCGAGATTTAGGTGGG + Intronic
933822068 2:86122396-86122418 CAAGAAATCCACATTTAGTTGGG - Intronic
934493109 2:94775685-94775707 TTACAATTCCACATGAGTTTTGG + Intergenic
934493452 2:94778167-94778189 TTACAATTCCACATGAGTTTAGG + Intergenic
934581102 2:95439614-95439636 ATAAAATTCCAAATTTATTAAGG - Intergenic
934598348 2:95637100-95637122 ATAAAATTCCAAATTTATTAAGG + Intergenic
935707199 2:105867424-105867446 AAACAAACCCACATTTATTTTGG - Intronic
937188092 2:120065236-120065258 CTACAGTCCCCCAGTTATTTGGG - Intronic
937490625 2:122363655-122363677 GTACAATACCATTTTTATTTTGG + Intergenic
937756465 2:125544971-125544993 CTACAATTACACTTTTTATTTGG - Intergenic
937805465 2:126138243-126138265 CTTCTATTCATCATTTATTTGGG + Intergenic
938279685 2:130055104-130055126 TTACAATTCCACACGAATTTTGG + Intergenic
938300316 2:130206383-130206405 CTACAACTACAAATATATTTAGG - Intergenic
938330635 2:130445814-130445836 TTACAATTCCACACGAATTTTGG + Intergenic
938359309 2:130675689-130675711 TTACAATTCCACACGAATTTTGG - Intergenic
938435710 2:131282338-131282360 TTACAATTCCACACGAATTTTGG - Intronic
941128950 2:161622906-161622928 ATACAATTTTACTTTTATTTTGG + Intronic
941809158 2:169738662-169738684 TTATAAATCCACTTTTATTTTGG + Intronic
941809686 2:169743380-169743402 TTATAATTTAACATTTATTTTGG - Intronic
942118056 2:172748595-172748617 CTACAATTCAAGATAGATTTGGG + Intronic
942409079 2:175687835-175687857 CTGCCATTCCACATTGATTATGG + Intergenic
942692328 2:178599188-178599210 CTCCAATGCCATATTTATTCTGG + Exonic
942961319 2:181832654-181832676 CTAAAATACAACATTCATTTTGG - Intergenic
943744732 2:191450099-191450121 CTAGAATTCAATATTTTTTTTGG + Intergenic
944887143 2:204074721-204074743 TTACAATTCCACATTCACTGTGG - Intergenic
945078278 2:206062657-206062679 CCAGAATTCAACATTTATATAGG + Intronic
945729355 2:213514306-213514328 CAAGAATGCAACATTTATTTAGG - Intronic
946756982 2:222957170-222957192 CTAAATTTCCATATGTATTTGGG + Intergenic
946963775 2:225014168-225014190 TTAAAAATCCACATTGATTTGGG - Intronic
947052112 2:226057208-226057230 CTACAATTCTACAATAATTCAGG + Intergenic
1169530547 20:6480690-6480712 CAACACTCCCACATTTATTAAGG - Intergenic
1170409186 20:16069995-16070017 CTTCAATTCCTCATTGATTGAGG + Intergenic
1170444594 20:16412749-16412771 CTACAATTCCAGATGAAATTTGG + Intronic
1171539329 20:25933634-25933656 GTACATTTCCAGATTTATTAAGG + Intergenic
1171801707 20:29626625-29626647 GTACATTTCCAGATTTATTAAGG - Intergenic
1171842262 20:30228846-30228868 GTACATTTCCAGATTTATTAAGG + Intergenic
1171883397 20:30633958-30633980 CTACAATTCCACATGAGTATTGG + Intergenic
1172431090 20:34892431-34892453 CTACAATTCCTGATTTGTGTGGG - Intronic
1174086097 20:48008367-48008389 CTACAATTCAACATGAAATTTGG + Intergenic
1174126778 20:48312168-48312190 CTACAATTATACAATTATTGTGG + Intergenic
1174272465 20:49379815-49379837 CAACAATTACATATTTATTTTGG - Intronic
1174675820 20:52354283-52354305 CTCCAATTGCATATCTATTTAGG + Intergenic
1174733857 20:52945231-52945253 CTCCAATTGCTCATTAATTTGGG - Intergenic
1174906619 20:54558664-54558686 GTACATTTCCTCATTTCTTTTGG - Intronic
1174920496 20:54696837-54696859 CTACAATTCAACATTAGATTTGG - Intergenic
1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG + Intergenic
1176844369 21:13865334-13865356 TTACAATTCCACATGAGTTTTGG + Intergenic
1176846258 21:13878857-13878879 CGACAATTCCACATGAATATTGG + Intergenic
1176847065 21:13884857-13884879 TTACAATTCCACATAAGTTTTGG + Intergenic
1176848992 21:13898399-13898421 CGACAATTCCACATGAATATTGG + Intergenic
1177245202 21:18514105-18514127 CCACACATCCACATTTTTTTTGG - Intergenic
1177467216 21:21501463-21501485 CTTCAAGTCCATATTTACTTAGG - Intronic
1178831138 21:36057637-36057659 TTACATTTCCACATGAATTTTGG - Intronic
1180735790 22:18016139-18016161 GTAAAATTCCATATTTATTGTGG - Intronic
1182298322 22:29323723-29323745 CTAAATTTCCACATATATCTGGG - Intergenic
1183326385 22:37196890-37196912 CTCCAATTTCCAATTTATTTGGG + Intronic
949245391 3:1920975-1920997 CTTCAAATTCACATTTATTTAGG + Intergenic
949422557 3:3881577-3881599 CAAAAATTCCTGATTTATTTAGG - Intronic
950314699 3:11990843-11990865 TTACATTTCCAGATTAATTTAGG + Intergenic
950766351 3:15276096-15276118 CTACATTTCCACATTTCTAAGGG - Intronic
950856736 3:16112756-16112778 CTACAATTCAAGATTTGTGTGGG + Intergenic
951323281 3:21272277-21272299 CTAGAAATCCAACTTTATTTAGG - Intergenic
951768486 3:26227709-26227731 CTATAATTGAACATTTATTAAGG + Intergenic
953302124 3:41787815-41787837 CTACTATTCCACATGTCTTAAGG - Intronic
956635458 3:71359690-71359712 CTACAATTCCAAAATTATTTGGG - Intronic
957966846 3:87333062-87333084 GCACACTTCCACATTTACTTAGG - Intergenic
958149007 3:89665526-89665548 TTACTATTCCACATGAATTTTGG + Intergenic
958578092 3:95978199-95978221 CTAGAATGTCACATTTATTTTGG + Intergenic
958843754 3:99240726-99240748 CTACTATTAGTCATTTATTTGGG - Intergenic
958990954 3:100844415-100844437 GTAAAAATCCACATTGATTTGGG - Intronic
959049506 3:101511782-101511804 AACCAATTCCAAATTTATTTAGG - Intronic
959182668 3:103001979-103002001 CATCAATTCTACATTTTTTTTGG - Intergenic
959655682 3:108801583-108801605 TTACAATTCAACATTAATTTTGG + Intergenic
959678210 3:109061571-109061593 CTTCCTTTCCCCATTTATTTAGG + Intronic
960464898 3:117985653-117985675 TACCACTTCCACATTTATTTTGG - Intergenic
960781745 3:121327252-121327274 CTGCAATTCTATTTTTATTTAGG + Intronic
960826894 3:121796648-121796670 CTACAATTAGAGATTTTTTTTGG + Intronic
962831841 3:139149195-139149217 GTACAGTTATACATTTATTTGGG - Intronic
963370576 3:144394720-144394742 CTAGAATTCTAGATTTAATTAGG + Intergenic
963577105 3:147074914-147074936 ATTAAATTCCATATTTATTTCGG + Intergenic
963617524 3:147560610-147560632 CTATCATTCCACATATATTTAGG + Intergenic
964517263 3:157525556-157525578 CCATAATTCCAAAATTATTTAGG + Intronic
964632309 3:158825084-158825106 CCACAGTTCAACATGTATTTGGG + Intronic
964673523 3:159252859-159252881 CGAAAATTCCAGATTTATTCAGG - Intronic
965010680 3:163085118-163085140 CTAAATTTCCACTTTAATTTTGG - Intergenic
965693415 3:171381614-171381636 CAAAAATTCCAATTTTATTTGGG + Intronic
966476282 3:180351337-180351359 CTACACTTCCATATTCATTGTGG - Intergenic
966513278 3:180787692-180787714 CTACAATTCCACATTGTATGAGG + Intronic
966825898 3:183964775-183964797 GAACAAATCCACATTTCTTTGGG - Intronic
967235266 3:187377879-187377901 CAATAATTCGACCTTTATTTTGG + Intergenic
968350662 3:198049314-198049336 CTACAATTCCACATGAGTTTTGG + Intergenic
968735065 4:2290993-2291015 CTGCATTTCCTCATTTTTTTAGG - Intronic
968931862 4:3584710-3584732 CTACACCTCCACAATTATGTGGG + Intronic
969534912 4:7750244-7750266 TTTTACTTCCACATTTATTTAGG - Intergenic
969950543 4:10831057-10831079 TTAGAATTCCACATTTATCTGGG - Intergenic
970165398 4:13231904-13231926 CTACAATTCAAGATGTAATTTGG + Intergenic
970376086 4:15458426-15458448 CTACAATTCAAGATTAAATTTGG + Intergenic
971000931 4:22321805-22321827 CTACAATTCAAGATGTGTTTTGG - Intergenic
972363237 4:38348251-38348273 CTACAATTCCAGATTTGGGTGGG + Intergenic
972662538 4:41130228-41130250 CTAGAATTTCACAGTTATCTAGG + Intronic
972748734 4:41967904-41967926 CTACAATTCAAGATTAAATTTGG - Intergenic
972958577 4:44423006-44423028 GTAAATTTCAACATTTATTTAGG + Intronic
973367054 4:49216275-49216297 CTACAATTCCACATGAGTATTGG + Intergenic
973999338 4:56495428-56495450 CTAAAATCAAACATTTATTTTGG - Intronic
974265094 4:59577044-59577066 CTACAATTCAAGATAGATTTGGG - Intergenic
974551162 4:63376690-63376712 GTAAAATGCCACAGTTATTTTGG + Intergenic
974755534 4:66202173-66202195 CCACATTTCCAGATGTATTTTGG + Intergenic
975014942 4:69403728-69403750 CTACAATTCAAGATTAAATTTGG - Intronic
975019898 4:69473766-69473788 CTTCAATTCGACATGTATTTTGG + Intergenic
976203504 4:82602334-82602356 CACCAATTACAGATTTATTTGGG - Intergenic
976335969 4:83886947-83886969 CTAAAATTCAATATCTATTTTGG - Intergenic
976868320 4:89758465-89758487 GTACAATTTCACATTGGTTTTGG + Intronic
977173697 4:93793965-93793987 AGACAATTCCACATTAGTTTAGG - Intergenic
977206409 4:94169563-94169585 CTACAATTCCACATGAGATTTGG - Intergenic
977308325 4:95352906-95352928 TTATAATTCCACATTCATTTGGG - Intronic
978555690 4:109977867-109977889 ATACAATTTTACATTTATTTGGG - Intronic
980840225 4:138250479-138250501 ATAAAATTCCAAATTTATTTGGG - Intergenic
980854880 4:138427405-138427427 CTTCAATACAACTTTTATTTTGG + Intergenic
981267922 4:142808894-142808916 TAACAAATCCACAATTATTTAGG - Intronic
981593864 4:146396473-146396495 CAACAATTCCTTCTTTATTTAGG - Intronic
981593973 4:146398208-146398230 CTACAATTTGACATTTATTTTGG + Intronic
982603148 4:157477992-157478014 CTAAAATTCAAAATATATTTTGG - Intergenic
984037447 4:174687258-174687280 AAACAATGCCACTTTTATTTCGG + Intronic
984275282 4:177602042-177602064 ATAGATTTCCACATTTATTTAGG - Intergenic
984410798 4:179395584-179395606 CTCTAATTACACATTTTTTTTGG - Intergenic
984571750 4:181403633-181403655 CTACAATTCCAGATGAAATTTGG + Intergenic
984746380 4:183223535-183223557 CTACAATGCCATTATTATTTTGG + Intronic
985792433 5:1937407-1937429 CTACAATTTCACATTGAAGTCGG + Intergenic
986440181 5:7774426-7774448 CAATAATGCTACATTTATTTAGG - Intronic
986575583 5:9209157-9209179 CTACAATTCTCCATATCTTTAGG + Intronic
986590862 5:9368268-9368290 ATACAATGCCACATATTTTTGGG - Intronic
986797560 5:11226739-11226761 CTACAATTCGAGATTTGTATGGG + Intronic
987167170 5:15212586-15212608 CTACATTTTCTCATTTATTTTGG - Intergenic
988084970 5:26463434-26463456 TTACAATTCCACATGAAATTTGG - Intergenic
988265724 5:28947714-28947736 CTACATCTCACCATTTATTTAGG - Intergenic
991133767 5:63156828-63156850 AAACAATTCCAAATGTATTTTGG + Intergenic
991222760 5:64235571-64235593 CTACAATTCCAAAGTTTTCTAGG + Intronic
992822681 5:80513847-80513869 CTACAATTCCATTTTCAGTTTGG - Intronic
993497998 5:88629756-88629778 CAACAATTCCACCTCTAATTTGG + Intergenic
994057503 5:95434837-95434859 CTGCAATTACAAATTTACTTAGG - Intronic
994683325 5:102917415-102917437 CTAAACTTTCACATATATTTTGG + Intronic
995127696 5:108595049-108595071 CTTCATTTCTACATTTCTTTTGG - Intergenic
995790848 5:115884659-115884681 TTACAATACCACATTTTTTAAGG + Intronic
995857493 5:116608511-116608533 CTACAATTCCACATGAGATTTGG + Intergenic
996830030 5:127730014-127730036 CTTCAGTTCCACTTTGATTTTGG - Intergenic
997609189 5:135200947-135200969 CTAGATTTCCACATGTAGTTGGG + Intronic
997660136 5:135582952-135582974 GTACATTTTCATATTTATTTGGG + Intergenic
997776651 5:136614633-136614655 CAAAAATTCAACAATTATTTGGG + Intergenic
998375284 5:141686639-141686661 TTGTAATTACACATTTATTTGGG - Intergenic
998826673 5:146108667-146108689 TTATAACTCCACATTAATTTTGG - Intergenic
999031653 5:148299869-148299891 CTCCAATTCCAGTTTTATGTAGG - Intergenic
1000302805 5:159971534-159971556 CCACAATTGCACATCTCTTTTGG - Intronic
1000487764 5:161869656-161869678 CTTCAATACAATATTTATTTAGG + Intronic
1000541069 5:162540775-162540797 CTACATTTCCACTTTGAATTAGG - Intergenic
1000733968 5:164874783-164874805 AAACAAAACCACATTTATTTAGG - Intergenic
1001655167 5:173343696-173343718 CTACAATTCAACATGAAATTTGG + Intergenic
1001859710 5:175043198-175043220 CTACATCTCCACATTTAGCTAGG - Intergenic
1002799310 6:505951-505973 ATAGAATTCTACATATATTTAGG - Intronic
1003799679 6:9649635-9649657 ATCCATTTCCACATTTATTCAGG + Intronic
1004126650 6:12880695-12880717 CTTCAATTCCACATTTGCTTAGG - Intronic
1004884450 6:20037899-20037921 TTACATTTCCACCTGTATTTTGG - Intergenic
1005704053 6:28433957-28433979 CTATAAATCTACATTTATATAGG + Exonic
1006462194 6:34167504-34167526 TTACAATTCCACATGAAATTTGG - Intergenic
1007371140 6:41427701-41427723 CAACAATAGCACTTTTATTTGGG + Intergenic
1008568106 6:52789123-52789145 CTAAAAATTCACATTTATTTGGG + Intergenic
1008572294 6:52827703-52827725 CTAAAAATTTACATTTATTTGGG + Intergenic
1008744880 6:54657682-54657704 ATACTTTTCCAAATTTATTTAGG - Intergenic
1008834599 6:55810194-55810216 GTATAATCCCACATTTATTTTGG - Intronic
1008945001 6:57087949-57087971 TTACAATTCCACATGGAATTTGG - Intronic
1009860556 6:69325768-69325790 TAACAATTCCAGAATTATTTAGG + Intronic
1010553097 6:77247226-77247248 CTTCAATTACAGATTTATTAAGG - Intergenic
1010557435 6:77301276-77301298 CTGCATTTCAACATTTACTTTGG + Intergenic
1012229037 6:96738564-96738586 TTACATTTCTACTTTTATTTAGG + Intergenic
1012301476 6:97593817-97593839 CTACAATTCTCCATTTATTTAGG - Intergenic
1013278397 6:108609230-108609252 TGACAATTCACCATTTATTTGGG - Intronic
1013730783 6:113164116-113164138 CTTCAATCCCTCAGTTATTTAGG - Intergenic
1013954659 6:115827178-115827200 CTACCATTTGAGATTTATTTTGG - Intergenic
1014336083 6:120139335-120139357 CTACAATTCCAGCTGAATTTTGG - Intergenic
1014591793 6:123281908-123281930 CTGGACTTCCACATGTATTTTGG - Intronic
1015176240 6:130312149-130312171 CAACACTTCCATATTTATTTAGG - Intronic
1015240616 6:131019078-131019100 CTGAAATTACCCATTTATTTGGG + Intronic
1016492200 6:144618259-144618281 CTACAATGCCACACTAAATTTGG + Intronic
1017390132 6:153929165-153929187 TTATTCTTCCACATTTATTTTGG - Intergenic
1021153271 7:17177918-17177940 CTCCAATTCATCATATATTTTGG + Intergenic
1021340108 7:19454622-19454644 CTACAATTCAAAATGAATTTTGG + Intergenic
1022759032 7:33327081-33327103 CTAGACTTTCAAATTTATTTGGG + Intronic
1023114195 7:36844934-36844956 TTTTAAATCCACATTTATTTTGG + Intergenic
1023118211 7:36883426-36883448 CTACAATTCCACATGAGATTTGG - Intronic
1023613626 7:41996185-41996207 CTATAATTCCCTCTTTATTTTGG + Intronic
1024169110 7:46765891-46765913 CTACAATTCGAAATTTTGTTGGG + Intergenic
1024546285 7:50523050-50523072 TTACAATTCCACATGGATTCGGG + Intronic
1027357347 7:77370897-77370919 CTACAATACCATACTTGTTTTGG + Intronic
1027407994 7:77882612-77882634 CTACAATTCTAGTGTTATTTCGG - Intronic
1027519753 7:79190974-79190996 CTATATTTCCACATATATGTGGG + Intronic
1027662907 7:81008787-81008809 TTGCAATTACATATTTATTTGGG - Intergenic
1027831362 7:83182135-83182157 TTACAATTCCACATGTGATTGGG + Intergenic
1028433254 7:90772428-90772450 TTACAATTCAACATTAAATTTGG - Intronic
1028619352 7:92806940-92806962 AAACAAATACACATTTATTTAGG + Intronic
1029408524 7:100392708-100392730 CTAAATTCCCACATATATTTGGG - Intronic
1030267458 7:107634978-107635000 CTACAATTCAACATTAGATTTGG - Intergenic
1031197225 7:118630883-118630905 CCAGAATTCCACATGTATTCTGG - Intergenic
1031874408 7:127121865-127121887 CTACAATTCCACATGGGATTTGG + Intronic
1032623536 7:133563259-133563281 TTAAAATTCCATTTTTATTTGGG - Intronic
1032835274 7:135666663-135666685 ATCCATTTCCTCATTTATTTAGG + Intronic
1033513416 7:142083039-142083061 TTACATTTCAACTTTTATTTTGG - Intronic
1035123498 7:156590071-156590093 CTACAGTTCAACATTTCATTGGG + Intergenic
1035406361 7:158600647-158600669 CTGTCATTCCCCATTTATTTGGG + Intergenic
1036096494 8:5730073-5730095 CTACATTTCCTCATTGAATTTGG - Intergenic
1036578427 8:10050487-10050509 GTATAGCTCCACATTTATTTAGG + Intergenic
1037316298 8:17602608-17602630 TTGAAATTCCACATTGATTTAGG + Intronic
1037471860 8:19218381-19218403 CTACAATTCAAGATAAATTTGGG + Intergenic
1037728180 8:21501325-21501347 CTACATTTCAACATAAATTTTGG - Intergenic
1039254261 8:35701728-35701750 AGACAATTCCACATTTTTATAGG + Intronic
1039927055 8:41944484-41944506 CCACAGTTCCACACTTATATTGG - Intronic
1040103598 8:43526233-43526255 TTACAATTCCACATGAGTTTTGG - Intergenic
1041210148 8:55541904-55541926 CTACAGTACCATAGTTATTTTGG + Exonic
1041551318 8:59104576-59104598 CTATAATTCAACATTTAAATTGG - Intronic
1042384838 8:68162138-68162160 CTAGAATTCCAGATTTAGGTTGG + Intronic
1042460783 8:69065042-69065064 CTACAACTGCACATATTTTTAGG - Intergenic
1042489883 8:69385153-69385175 CTACAATTCAAGATTTAGGTTGG - Intergenic
1042653362 8:71067558-71067580 ATACACGTCCACTTTTATTTAGG - Intergenic
1043065193 8:75560510-75560532 CCACAATTCCACTTTTTCTTGGG - Intronic
1044850870 8:96426165-96426187 GTGCACTTCCACATTTATTGTGG - Intergenic
1045256180 8:100524570-100524592 CTACAACACCACAGTAATTTTGG + Intronic
1045793378 8:106013064-106013086 CTAGATTTCCACATCTAGTTAGG - Intergenic
1046002432 8:108437184-108437206 TTTCTATTACACATTTATTTTGG - Intergenic
1046143413 8:110124354-110124376 CTACAGTCCCACATTTACTGAGG - Intergenic
1047035596 8:120935300-120935322 CTACAATTCAAGATGAATTTGGG - Intergenic
1047060782 8:121222562-121222584 GTACTATACCTCATTTATTTCGG + Intergenic
1047595321 8:126372101-126372123 TCACAATTCCCCATTTATCTAGG - Intergenic
1048045298 8:130767228-130767250 CTACAATTCAACATGAAATTTGG + Intergenic
1049859223 8:144886599-144886621 TTATAATTAAACATTTATTTCGG - Intronic
1050822315 9:9894668-9894690 TTACCATTTCACATATATTTGGG + Intronic
1051455503 9:17252185-17252207 CTGCAATTGAACATTTATTGTGG - Intronic
1053663617 9:40301870-40301892 TTACAATTCCACATGAGTTTAGG - Intronic
1053665880 9:40317265-40317287 TTACAATTCCACATGAGTTTTGG - Intronic
1053914132 9:42932412-42932434 TTACAATTCCACATGAGTTTAGG - Intergenic
1053915459 9:42942310-42942332 TTACAATTCCACATGAGTTTTGG - Intergenic
1054165727 9:61725816-61725838 GTACATTTCCAGATTTATTAAGG - Intergenic
1054375741 9:64448103-64448125 TTACAATTCCACATGAGTTTAGG - Intergenic
1054458266 9:65447219-65447241 CTACACCTCCACAATTATGTGGG - Intergenic
1054518731 9:66059018-66059040 TTACAATTCCACATGAGTTTTGG + Intergenic
1054520998 9:66074415-66074437 TTACAATTCCACATGAGTTTAGG + Intergenic
1054801743 9:69356688-69356710 CTTCAAATCAAAATTTATTTTGG + Intronic
1054838385 9:69705902-69705924 CAAGACTTCCACATTCATTTAGG + Intergenic
1054897216 9:70328116-70328138 TTACAATTCAACATTTGATTTGG + Intronic
1055735823 9:79328850-79328872 TTACAATTCAACATGAATTTGGG + Intergenic
1055849303 9:80606558-80606580 CAAGAAATCCACACTTATTTTGG - Intergenic
1056314953 9:85379263-85379285 CTAAAATCCCAAATATATTTGGG + Intergenic
1057845723 9:98520959-98520981 TTAAAATTCCTCATTTATATTGG - Intronic
1059708346 9:116844341-116844363 CTACGAGTCCACAGCTATTTGGG + Intronic
1185983732 X:4807572-4807594 CAATAATTCCACAAATATTTGGG + Intergenic
1187871858 X:23771272-23771294 GTACTATGCCATATTTATTTTGG + Intergenic
1187872458 X:23775862-23775884 GTACTATGCCATATTTATTTTGG + Intergenic
1188292456 X:28406107-28406129 TTACAATTCCACATGTGATTTGG + Intergenic
1188509150 X:30915285-30915307 CTAAAACACCACAATTATTTTGG - Intronic
1188683840 X:33045020-33045042 CAACAATTACTCCTTTATTTGGG - Intronic
1189402222 X:40680861-40680883 CAAAAATTCCACATTTCTTTGGG - Exonic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1189706419 X:43763211-43763233 ATTCAATTCCTCATGTATTTAGG + Intergenic
1190521660 X:51284964-51284986 CTAGAATACCACATTATTTTTGG + Intergenic
1194235854 X:91382370-91382392 CTACAATTCAACATGAGTTTTGG - Intergenic
1195169285 X:102250079-102250101 AGACACATCCACATTTATTTTGG + Intergenic
1195177443 X:102324462-102324484 CTGCATTTCCACATGAATTTTGG - Intronic
1195181421 X:102362631-102362653 CTGCATTTCCACATGAATTTTGG + Intronic
1195189572 X:102437009-102437031 AGACACATCCACATTTATTTTGG - Intronic
1195496869 X:105546364-105546386 CGAGAATTCCATATTTATTTAGG + Intronic
1195546218 X:106115235-106115257 CTACCATGCCACAATTATCTGGG + Intergenic
1195554426 X:106205603-106205625 CTTCAATTTGAGATTTATTTAGG - Exonic
1195588915 X:106601433-106601455 TTACAATACCACATTTTTTTTGG + Intergenic
1196416401 X:115476370-115476392 TTACAATTCAGCATTTAATTTGG - Intergenic
1197582927 X:128307863-128307885 CATCAATTACACATTTAATTGGG - Intergenic
1198483434 X:137062447-137062469 TTAAAGTTCCACATTTATTGTGG + Intergenic
1199182645 X:144876672-144876694 CTACAATTCAAGATGAATTTTGG + Intergenic
1200307499 X:155042608-155042630 TTCCAATTACACATTTATTAGGG + Intronic
1201319421 Y:12681515-12681537 GTACAACTCCTCTTTTATTTTGG + Intergenic