ID: 917654409

View in Genome Browser
Species Human (GRCh38)
Location 1:177112091-177112113
Sequence CAGATTGCACATATAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917654409_917654418 20 Left 917654409 1:177112091-177112113 CCCTCCTCTATATGTGCAATCTG 0: 1
1: 0
2: 0
3: 13
4: 134
Right 917654418 1:177112134-177112156 AGAATGTTTTGCTTTTTCAGTGG 0: 1
1: 0
2: 3
3: 36
4: 553
917654409_917654415 -10 Left 917654409 1:177112091-177112113 CCCTCCTCTATATGTGCAATCTG 0: 1
1: 0
2: 0
3: 13
4: 134
Right 917654415 1:177112104-177112126 GTGCAATCTGGGTTCCAGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917654409 Original CRISPR CAGATTGCACATATAGAGGA GGG (reversed) Intronic
901327580 1:8377666-8377688 AAGATTGCACATATAATGAAAGG - Intronic
902244564 1:15111973-15111995 CAGATTGCAAATTCAGAGCAGGG + Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902982561 1:20136255-20136277 CAAATTACACATTTAGGGGAGGG - Intergenic
904110690 1:28123743-28123765 CAGAATGGACATTTAGAGGGAGG - Intergenic
904254878 1:29248488-29248510 CAGGTTGCACATTTAGGGGCTGG - Intronic
906852804 1:49270013-49270035 CAGATTGCACAGAGAGAGGTTGG - Intronic
909698965 1:78499235-78499257 AAGATAGCCCAGATAGAGGAGGG - Intronic
911143473 1:94530684-94530706 CAAATTGCACAAAAATAGGATGG - Intronic
913615986 1:120559513-120559535 TAGATTGCACACAAAGAGGAGGG + Intergenic
914574292 1:148951385-148951407 TAGATTGCACACAAAGAGGAGGG - Intronic
917654409 1:177112091-177112113 CAGATTGCACATATAGAGGAGGG - Intronic
922903742 1:229158191-229158213 AAGATTGACAATATAGAGGAGGG + Intergenic
1064862472 10:19842710-19842732 CACATTGCAAATTTAGAAGAAGG + Intronic
1066281585 10:33923296-33923318 TAGATTGGACATGGAGAGGAGGG - Intergenic
1066702102 10:38141243-38141265 CAATTTTAACATATAGAGGATGG + Intergenic
1071273247 10:84028308-84028330 TACATTGCACATATAAAGCATGG + Intergenic
1071710403 10:88043798-88043820 CAGAATGAACATAGATAGGAAGG - Intergenic
1072188904 10:93065072-93065094 CACATCGCACATACAGTGGAGGG + Intronic
1076303977 10:129450249-129450271 CAGCTTCCCCATCTAGAGGATGG - Intergenic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1080643560 11:34172745-34172767 GATAATGCACATAAAGAGGAAGG + Intronic
1084697172 11:70762668-70762690 CAGATGGCTCATACTGAGGAAGG - Intronic
1085321047 11:75574242-75574264 CATCATGCACATATCGAGGAAGG + Intergenic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091047894 11:132341264-132341286 CAGAGTGCACATGTGGATGAGGG + Intergenic
1092156100 12:6282413-6282435 CAGATTGCAAATGGAGAGGAAGG - Intergenic
1096439781 12:51631198-51631220 CAGATGGCACAGATAGAAAAGGG - Intronic
1098700382 12:73616288-73616310 ATGATTCCATATATAGAGGAAGG + Intergenic
1099902835 12:88734031-88734053 CAGAGTGAACTCATAGAGGAGGG + Intergenic
1100075490 12:90777710-90777732 CAAATTGCACATATATAAAAAGG - Intergenic
1104063373 12:125286398-125286420 CAGTTTCTACATATAGAGAATGG + Intronic
1107315660 13:39128791-39128813 CAGTTTGCAGAAATAGCGGAGGG + Intergenic
1108262941 13:48676499-48676521 GATATTGTACATATAGAGTAGGG + Intronic
1111729427 13:92054073-92054095 AAGATTTCACTTATAGAGGCAGG + Intronic
1114209850 14:20605287-20605309 CAGACAGTACATATATAGGAGGG - Intronic
1115103449 14:29731834-29731856 CAGACTGCACAAAAAGATGAGGG - Intronic
1117791899 14:59350289-59350311 GAGGTTGCAGATATAGAGAAGGG - Intronic
1117820072 14:59639187-59639209 CAAACTGCACCTATAGAAGATGG - Intronic
1120734662 14:88039542-88039564 TAGATGCCACATATTGAGGATGG + Intergenic
1124650480 15:31470132-31470154 CAGAATGTATATATAGAAGAAGG - Intergenic
1126721790 15:51589037-51589059 CAGATGGCAGAATTAGAGGATGG + Intronic
1127135342 15:55915897-55915919 GAAATTGCACATAATGAGGATGG - Exonic
1134880177 16:17739477-17739499 CAGGTTGCACTTATGGAGGGAGG - Intergenic
1138792817 16:59927746-59927768 TATAATGCACATATAGGGGATGG - Intergenic
1139752057 16:69114932-69114954 AAGGCTGGACATATAGAGGAGGG - Exonic
1144370696 17:14588773-14588795 CAGATTAAACATCTAGATGATGG - Intergenic
1145049298 17:19647419-19647441 CACATTGCACAAATAGAAAAAGG + Intergenic
1145817708 17:27807508-27807530 CAGATAGCAAATACAGAGAAGGG - Intronic
1147191909 17:38742788-38742810 CAGATGGCACGTACACAGGATGG - Intronic
1147371993 17:39998771-39998793 CAAATTGCACCCATATAGGATGG + Intergenic
1155620991 18:27779463-27779485 CATCTTCCACAGATAGAGGAAGG - Intergenic
1156097782 18:33556570-33556592 CAGTTTGTACATATACAGAAAGG - Intergenic
1156604447 18:38649645-38649667 CCATTTGCATATATAGAGGACGG - Intergenic
1157714721 18:49875901-49875923 CAGATGGCTGATATAGAGGGAGG - Intronic
1158994533 18:62904417-62904439 CAGAATGCATTTATAGAAGAAGG + Intronic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1163335826 19:16671026-16671048 CAGTTTGCCCATATGTAGGAGGG - Intronic
1164511866 19:28904128-28904150 CAGATGGCACAGGTAGGGGATGG - Intergenic
1168724233 19:58572027-58572049 GAGGTTGCACATGTAGAAGAAGG - Intronic
925476366 2:4221116-4221138 CATATAGAATATATAGAGGAAGG - Intergenic
926954008 2:18273375-18273397 CAGAATGCAAATTCAGAGGAAGG - Intronic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
929922297 2:46181295-46181317 GAGATTGCACATAGTGGGGATGG + Intronic
936754801 2:115694962-115694984 GAAATTGCAGATATAGAGGAAGG + Intronic
939419309 2:141945351-141945373 CATATTGTACACATAGAGAATGG + Intronic
940098977 2:150011584-150011606 CACTTTGCAGATAAAGAGGAGGG + Intergenic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
942193002 2:173489582-173489604 CAGATTTCATATCTGGAGGAGGG - Intergenic
942281595 2:174369786-174369808 CAAACTGCACCTATAGAAGATGG - Intronic
943705008 2:191025336-191025358 CTGATTCCACTTATGGAGGAAGG - Intergenic
945656997 2:212636417-212636439 CATATTGAACATATAGCAGATGG + Intergenic
946770031 2:223079558-223079580 GAGATTGCACATACTAAGGAGGG + Intronic
947898302 2:233695780-233695802 CAGATAGTACATATACAGAATGG - Intronic
1173018151 20:39245470-39245492 CAGATCCCACAAACAGAGGATGG + Intergenic
949415301 3:3807453-3807475 CACATCACACATATAGAGCAGGG + Intronic
952590255 3:34944314-34944336 CAGATGGGACAGAGAGAGGAAGG - Intergenic
953528871 3:43720294-43720316 CAGGTTTCACTTATACAGGAAGG + Intronic
955063053 3:55510681-55510703 CAGATTAAAGAAATAGAGGAGGG + Exonic
955613337 3:60780443-60780465 CAGTTTGCACACGTAGAGGGAGG - Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
957743213 3:84302064-84302086 ATGATTGCACATATATAGCATGG - Intergenic
965507016 3:169527758-169527780 CAGATTGCAAATAAAGAGAGAGG - Intronic
965734337 3:171804988-171805010 CAGATGGCACATTTAGATGAAGG - Intronic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
967652121 3:191998760-191998782 GAGCTTGAACATTTAGAGGAGGG + Intergenic
969261352 4:6036118-6036140 CAGATCACACAGACAGAGGAAGG + Intronic
971639683 4:29116559-29116581 CAGATTTCCCATATACTGGACGG + Intergenic
972016868 4:34257852-34257874 CAGATTGCACATTTAAACTATGG - Intergenic
974842418 4:67313176-67313198 GAGATTGCAGATATTGAGAATGG + Intergenic
975423291 4:74195356-74195378 ATGGTTGCACATATAGAAGAAGG + Intronic
975536152 4:75453016-75453038 CTGATTGCCCAAGTAGAGGAGGG + Intergenic
977191704 4:94009151-94009173 CAGATTGGATATATATAGCAGGG - Intergenic
979201681 4:117986187-117986209 GAGATTGAACAAATAGGGGAAGG + Intergenic
980455391 4:133034079-133034101 AACATGGCACATATATAGGATGG + Intergenic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
984540181 4:181028577-181028599 CACATTGCAGAGATAGATGAAGG - Intergenic
985528197 5:418472-418494 CAGATGGCACATGTGGAGGAGGG - Intronic
985937656 5:3109074-3109096 CAGAATGCACACATCGAGGATGG - Intergenic
986450308 5:7856861-7856883 CACATTCCTCACATAGAGGAAGG + Intronic
988360335 5:30229522-30229544 GAGATTACACATACAGAAGAGGG + Intergenic
989036320 5:37176278-37176300 CAAATTTCACCTATAGAAGAGGG + Intronic
989626371 5:43432950-43432972 CAGCATGCACATAAAGTGGAAGG - Intergenic
993099486 5:83519771-83519793 CAGATTGAACAAATAGAAGTGGG + Exonic
995355580 5:111234405-111234427 CAGATTGCACATCAAGCAGAGGG + Intronic
995547436 5:113247128-113247150 TAGTTTACACATATGGAGGAAGG + Intronic
997133378 5:131299397-131299419 CAGATTGGACAAATAGAACATGG + Intronic
1003647094 6:7921723-7921745 CATATTAGACATAGAGAGGAAGG - Intronic
1005023141 6:21436742-21436764 CAGCTTGTTCACATAGAGGATGG - Intergenic
1005581743 6:27241749-27241771 CTGCTTGCACACACAGAGGAGGG - Intergenic
1014184498 6:118419802-118419824 CAAATTGGAAATAGAGAGGAAGG - Intergenic
1015085190 6:129282395-129282417 CAGTTCCCACATATAGAGAAAGG - Intronic
1015932007 6:138370433-138370455 CCGAATGCACATGTATAGGAGGG - Intergenic
1019423336 7:961939-961961 CAGATCGCACAGATAGATGATGG - Intronic
1021079277 7:16344198-16344220 CATATTGCCAATATAGAGGAGGG + Intronic
1024175872 7:46840601-46840623 AAGAATGCAAATATAGGGGATGG + Intergenic
1024591974 7:50894718-50894740 CATATCACACATATAGAAGAGGG - Intergenic
1032347309 7:131128161-131128183 CAGCTTGAACATAAAGAGAAGGG + Intronic
1034464576 7:151219059-151219081 CAGATTGCACACATGAAGGTAGG - Exonic
1036962215 8:13257018-13257040 CAGATTGCAAATAAAAAAGAGGG - Intronic
1037809180 8:22076277-22076299 AAGATTGTACAGAGAGAGGAGGG + Intronic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1040544151 8:48384001-48384023 CAGATAGCACATGTAGGGAAGGG + Intergenic
1043828501 8:84959356-84959378 CAGATTTCAAATATAAAGTAAGG - Intergenic
1044083994 8:87921155-87921177 CAGATAGAACAAAAAGAGGAAGG + Intergenic
1044321955 8:90812132-90812154 GAGAATGCAGGTATAGAGGAGGG + Intronic
1045428029 8:102086610-102086632 AAAATTACACTTATAGAGGATGG - Intronic
1048525055 8:135194889-135194911 GAAATTGCACAAATAGGGGAAGG - Intergenic
1049280451 8:141741460-141741482 CAGCTGGAACATAGAGAGGAAGG - Intergenic
1052602206 9:30648239-30648261 GAGATTGCACATAGAGATGAAGG - Intergenic
1053334076 9:37248317-37248339 CAGATTGCACATCTAGAAGCAGG - Intronic
1056676524 9:88680964-88680986 CAGATGGCACATACAGAGTCTGG - Intergenic
1058500054 9:105604321-105604343 CAGTTTGCAGATATAGTGCAGGG - Exonic
1188597273 X:31916788-31916810 TATATTGCACAGAAAGAGGAAGG + Intronic
1188810749 X:34651503-34651525 CAGATAGGACATAATGAGGATGG - Intronic
1189401114 X:40669572-40669594 CAGATTTCACAGAGAAAGGAGGG - Intronic
1190007295 X:46752628-46752650 CAGATTAAACACATACAGGAAGG + Intronic
1190472033 X:50791845-50791867 CAGTATGTACATATAGAGCAAGG + Intronic
1190491148 X:50983659-50983681 CAGTTTGCACATGGAAAGGAGGG - Intergenic
1193735948 X:85156551-85156573 CAAATTGCACAAATATGGGATGG + Intergenic
1194933611 X:99919258-99919280 CAGATTGCAAATAGTGAGTATGG - Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1196208016 X:112963067-112963089 CTGATTTAAAATATAGAGGAAGG + Intergenic
1198146808 X:133866080-133866102 CTTATTGCTCACATAGAGGAAGG - Intronic
1199426430 X:147706557-147706579 CAGATTTACCTTATAGAGGAAGG + Intergenic
1200880005 Y:8202675-8202697 CAGCTGGAACATATAGAAGAGGG + Intergenic
1202191913 Y:22254214-22254236 CAGCTGGGACATATAGAAGAGGG + Intergenic