ID: 917655635

View in Genome Browser
Species Human (GRCh38)
Location 1:177122771-177122793
Sequence TCCTCCTTATTTCAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917655634_917655635 2 Left 917655634 1:177122746-177122768 CCTGCAAGAGAGGTGACAGGAAT 0: 1
1: 0
2: 0
3: 10
4: 171
Right 917655635 1:177122771-177122793 TCCTCCTTATTTCAAAGAACTGG 0: 1
1: 0
2: 0
3: 21
4: 213
917655630_917655635 27 Left 917655630 1:177122721-177122743 CCTAACTCATCAGACACACGGCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 917655635 1:177122771-177122793 TCCTCCTTATTTCAAAGAACTGG 0: 1
1: 0
2: 0
3: 21
4: 213
917655632_917655635 6 Left 917655632 1:177122742-177122764 CCTTCCTGCAAGAGAGGTGACAG 0: 1
1: 0
2: 1
3: 26
4: 176
Right 917655635 1:177122771-177122793 TCCTCCTTATTTCAAAGAACTGG 0: 1
1: 0
2: 0
3: 21
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917655635 Original CRISPR TCCTCCTTATTTCAAAGAAC TGG Intronic
903363983 1:22794655-22794677 TCATCCCTATTTCACAGAAGAGG + Intronic
904889712 1:33770738-33770760 TCATCCTTGTTTCAAACCACAGG + Intronic
906521456 1:46469266-46469288 TCATCCTTATTTTAAAGATGAGG - Intergenic
907656145 1:56343321-56343343 CCCTCCTTAGGTCAAAGAAAAGG + Intergenic
907904767 1:58774357-58774379 TCTTCCTGACTCCAAAGAACTGG - Intergenic
910106314 1:83634573-83634595 TCCTGCTTATTTTATAGTACTGG - Intergenic
911136424 1:94445600-94445622 CCCTCCTTATTTTGAAGAAAAGG + Intronic
915116883 1:153606962-153606984 TCATCATTATTTCAAGCAACAGG + Exonic
915746265 1:158161079-158161101 TGCTGCTTCTTTCAAAGAAGGGG - Intergenic
916264097 1:162872749-162872771 TTCTCCTTCTTTCAAAGTAGTGG - Intergenic
916732598 1:167580044-167580066 TGATTCTCATTTCAAAGAACTGG + Intergenic
916994017 1:170276206-170276228 TCCTCCCTATTTCATAGATAAGG - Intergenic
917144483 1:171874324-171874346 TCTTAATTATTTCAAAGAATTGG + Intronic
917655635 1:177122771-177122793 TCCTCCTTATTTCAAAGAACTGG + Intronic
919314906 1:195959730-195959752 ACATCCTTCTTTCAAAGAAGAGG + Intergenic
919841667 1:201613920-201613942 TCATCCCTATTTCAAAGATGAGG + Intergenic
921219850 1:212965740-212965762 TTTTCCTAATTTCAAAGAACTGG - Intronic
921481920 1:215673826-215673848 TCCTACTTATTTCAGATACCAGG + Intronic
924105542 1:240645528-240645550 TCCCGCTTATTTCTAAGATCCGG + Intergenic
924329535 1:242928031-242928053 TTCTCCTTATTTTACAGATCAGG - Intergenic
1062982304 10:1736004-1736026 GCCTCCTGCTTTCAAACAACTGG + Intronic
1065423442 10:25573542-25573564 TCCTCCTTTTTTCAAAACACTGG - Intronic
1066040097 10:31540626-31540648 TCCACCTTATCTCAAAACACTGG + Intergenic
1066213926 10:33267395-33267417 TCCTCTTTACTTGTAAGAACAGG + Intronic
1067716074 10:48691992-48692014 TCCTCCTTCTCCTAAAGAACAGG - Intronic
1067808907 10:49411992-49412014 TCCTCCTGCTTTAAAAAAACAGG + Intergenic
1069039745 10:63683356-63683378 TCCTTCTTATTTTCAAGAAAAGG - Intergenic
1070740947 10:78902915-78902937 TCTTCCTTTTTTCACAGAATGGG - Intergenic
1070946152 10:80393551-80393573 TACTACTTATTACAAACAACAGG + Intergenic
1072305040 10:94099194-94099216 TCCTCGCTATTTTAAAGAAGAGG - Intronic
1072560114 10:96564294-96564316 TCCTTCATATTTGAGAGAACAGG - Intronic
1072705850 10:97680383-97680405 TCCTCCTCATTTCACAGATGAGG + Intronic
1073570523 10:104577268-104577290 TCCTTCTTCTATCAAAGAATGGG - Intergenic
1073914941 10:108391789-108391811 TCCTCCTGATTGCAAAGTCCAGG - Intergenic
1074338109 10:112598755-112598777 TCCAGCTTATTTAAAAGAAAGGG - Intronic
1074338887 10:112606463-112606485 TCCTCATTATTTCCAGGAAGTGG + Intronic
1074887112 10:117702533-117702555 TCCCCATTATTTCAAAAAAAAGG + Intergenic
1075747911 10:124740933-124740955 TCTTCCTCTTTTGAAAGAACCGG - Intronic
1075866792 10:125729336-125729358 TCCTCCCTATTTTAAATCACAGG + Exonic
1077209370 11:1361548-1361570 ACCTTCTTAGTGCAAAGAACAGG + Intergenic
1081118854 11:39238831-39238853 TCCTAATTATTTCCAAGAAAAGG + Intergenic
1081649019 11:44810940-44810962 TCCTCATATTTTAAAAGAACAGG + Intronic
1082730961 11:56797024-56797046 CCCTCCTCATTTCATAGAGCAGG + Intergenic
1083063259 11:59897003-59897025 TACTTGTTATTTCAAATAACTGG + Intergenic
1085769661 11:79313544-79313566 TCCTGCTGATTTCAAGGATCTGG + Intronic
1088182646 11:107129578-107129600 TCCTGCTTACTTCCATGAACGGG + Intergenic
1090311974 11:125749013-125749035 TCCTCCTTTTCTGAATGAACTGG - Exonic
1095197002 12:39331588-39331610 TCTTCCTTATTACAAAGCAAAGG + Intronic
1095448757 12:42307625-42307647 TCTTCCTTATTTCCAGGAATGGG + Intronic
1096835695 12:54349779-54349801 TCCCTCTTATTCCAGAGAACTGG + Intronic
1097356058 12:58603129-58603151 TCCTCCATATTTCAACCAAAGGG - Intronic
1097902810 12:64890153-64890175 TCCTTCTTATCTCAAAGAAGAGG - Intergenic
1098612493 12:72477770-72477792 AACTCCTTATTTTAAAGATCTGG + Intronic
1098666099 12:73164438-73164460 TCCTCCTTTTTTTAAAAAAGTGG + Intergenic
1098922007 12:76311313-76311335 TCATTCTTATTTCTAAGAACAGG - Intergenic
1099592224 12:84609393-84609415 TTCTTCTTATTTCAGAGAATTGG + Intergenic
1100487138 12:95041181-95041203 ACCTCCCTATTTAAAAAAACTGG + Intronic
1101041501 12:100760517-100760539 TACTCCTCATTTTAGAGAACAGG - Intronic
1102059561 12:109922506-109922528 TTCTCCACATTTCACAGAACTGG - Intronic
1102106878 12:110332697-110332719 TCCTCCTCATTTAAAGGATCTGG + Intronic
1102731696 12:115116911-115116933 TTCTCGATATTTCAAATAACTGG + Intergenic
1103861121 12:124014921-124014943 TCCTCCTTTTTACAAAGAGAGGG + Exonic
1103953094 12:124562452-124562474 TGCTCCTTTTTTCAGAGACCAGG + Intronic
1108426691 13:50309506-50309528 TCCTCCTTCTGTCAGAGAACAGG - Intronic
1108470614 13:50763223-50763245 GCCTCCTTATTACAATGAATGGG - Intronic
1109266100 13:60202026-60202048 TCCTCCTTATTCCAAATACAAGG - Intergenic
1109877197 13:68420839-68420861 TCCACATTACTGCAAAGAACTGG + Intergenic
1110262948 13:73506614-73506636 TCCTCCTTTTTTCTGATAACAGG + Intergenic
1112172177 13:96985093-96985115 TCCTTCTTATTCCAAAGAGTTGG - Intergenic
1115411601 14:33081718-33081740 TCCTCTTTATTCCCCAGAACTGG + Intronic
1119542197 14:75447232-75447254 TCCTCGCTCCTTCAAAGAACTGG - Intronic
1119846398 14:77833520-77833542 TCTCCCTAATTCCAAAGAACTGG - Intronic
1122452647 14:101823031-101823053 TCCTCCTTTTTACAAATAAAGGG - Intronic
1123451340 15:20363490-20363512 TTCTCCAAATTTTAAAGAACAGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1125160568 15:36639031-36639053 TCCTCCTTATTTTAGAGATGGGG - Intronic
1130007402 15:80112981-80113003 TCCGCCTTTTTTCAAATCACTGG - Intronic
1130741208 15:86602434-86602456 TCATCCTCATTTCAAAGAGAGGG + Intronic
1131850363 15:96536608-96536630 ATCTCCTTATATCACAGAACTGG + Intergenic
1136179325 16:28539942-28539964 TCATCCTTATTTTACAGAATTGG - Intergenic
1138311381 16:56026384-56026406 TCCTCCGTATTTCAGAGATTTGG - Intergenic
1140580778 16:76228447-76228469 TTCTCCTTATTTGGAAGACCAGG - Intergenic
1141289832 16:82707513-82707535 TTTTCCTTATTTTAAAGAAATGG + Intronic
1145746893 17:27326743-27326765 TCATCCTTATTTTACAGAAGAGG + Intergenic
1148193898 17:45699583-45699605 TCCTGCTTATTTTACAGAACGGG - Intergenic
1150721210 17:67615733-67615755 TCCTTCTTATTTCAATTCACAGG - Intronic
1151022756 17:70637849-70637871 CCCTACTTATTTCTAAGAATAGG + Intergenic
1152514355 17:80814205-80814227 TCCTTCTTATTTAAAAAAAGGGG + Intronic
1153794714 18:8610783-8610805 TGCCCTTTATTTTAAAGAACGGG - Intronic
1154101816 18:11482191-11482213 TCCTTCCTATTTCAAAGGAGTGG - Intergenic
1157169936 18:45393887-45393909 TCATCCTTATTTCACAGAAGAGG + Intronic
1158036471 18:53037706-53037728 TCCACCTGATTTCAAAGACCGGG - Intronic
1160467736 18:79095840-79095862 TCCTCTTGATTTCAAGAAACAGG - Intronic
1166473701 19:43102302-43102324 TCCTCCTAATTGTAAAGTACAGG + Intronic
1168361757 19:55746669-55746691 TCCTCTTCATTTCACAGAAGAGG - Intergenic
925793657 2:7519752-7519774 TGCTCCTTATTCCAATGAAATGG - Intergenic
926485637 2:13452794-13452816 TTCTCCAAATTTTAAAGAACAGG - Intergenic
927017857 2:18985438-18985460 TCCTGCTTATTTCACAGATGGGG - Intergenic
928895014 2:36251388-36251410 TTTTCTTTCTTTCAAAGAACAGG - Intergenic
928982506 2:37151582-37151604 TCCTAGATATTTCAAAGAATTGG + Intronic
929035778 2:37690304-37690326 TCCACCTCATTTTATAGAACTGG + Intronic
929632593 2:43480197-43480219 TCATCCTCATTTCACAGAAGAGG - Intronic
929691276 2:44076062-44076084 TTCTCCTTCTGTCAAAGAAGAGG - Intergenic
931906410 2:66848256-66848278 CACTCCTGATTTCAAAGACCTGG - Intergenic
933913738 2:86967431-86967453 TCCTCCTTCTTTTAAAGACAGGG - Intronic
935772839 2:106443177-106443199 TCCTCCTTCTTTTAAAGACAGGG + Intronic
935907230 2:107852752-107852774 TCCTCCTTCTTTTAAAGACAGGG - Intronic
936129021 2:109817893-109817915 TCCTCCTTCTTTTAAAGACAGGG - Intronic
936215676 2:110553592-110553614 TCCTCCTTCTTTTAAAGACAGGG + Intronic
936424813 2:112408165-112408187 TCCTCCTTCTTTTAAAGACAGGG + Intronic
936914083 2:117622488-117622510 TCCTCTTTATTTCTATTAACTGG - Intergenic
936980881 2:118264095-118264117 TCCTCCTGATTCCAATGAACAGG + Intergenic
938638382 2:133253373-133253395 TCTTCCTTATTTCATGGAAGAGG + Intronic
938750085 2:134320173-134320195 TCCTCCTCCTTTTAAAGACCAGG + Intronic
940040071 2:149350936-149350958 CCCTGCTTATTTCCAGGAACTGG + Intronic
940734440 2:157433300-157433322 TCCTCCAAATTTAAAAGTACAGG + Intronic
941296015 2:163738548-163738570 TCCTCCTCTTTTTAAAGAGCAGG - Intergenic
942841817 2:180370898-180370920 TCCTGCTTATTTCAGATAACTGG + Intergenic
942914188 2:181283265-181283287 TCTTCCTTGGATCAAAGAACTGG - Intergenic
944462541 2:199966062-199966084 TTCTCCTTGTTTCAAAGATATGG - Intronic
946208401 2:218127622-218127644 TGCTCCTTATTACAGTGAACAGG + Intronic
946583983 2:221162735-221162757 TCCTCCATTTTTCATAGAAGGGG - Intergenic
948646061 2:239405888-239405910 TGCTACTTATTTCAATGAGCTGG - Intergenic
1170034095 20:11972012-11972034 TCCTTTTTATTTCAAGGAAAAGG - Intergenic
1174011445 20:47452975-47452997 TCATCCTTATTTTATAGATCAGG - Intergenic
1174461459 20:50685924-50685946 TCTTCCTTCTTTCAACCAACAGG - Intronic
1177528044 21:22322773-22322795 TCTTCTTTATTTTAAAAAACTGG + Intergenic
1178445851 21:32641001-32641023 TCCTCCTTTTTTCAAAAAAAGGG - Intronic
1182091282 22:27596641-27596663 TCCTCCTAATTTCCACGAAGCGG + Intergenic
950650084 3:14401824-14401846 TTGTCCTTATTTGAATGAACGGG - Intergenic
950837359 3:15933430-15933452 TCCTCCTCCTTTCAAACAAACGG + Intergenic
951988085 3:28643201-28643223 TCTTCCTAAATTCAAAGCACTGG - Intergenic
952212342 3:31240995-31241017 TCCTTCTTATTTCATAGAAAAGG - Intergenic
952885225 3:38007824-38007846 TCCACCTCATGTCTAAGAACGGG - Exonic
955078201 3:55633531-55633553 TGCTCCTTATTTCAAGGGCCTGG + Intronic
955616689 3:60815754-60815776 TCTACCATATTTCACAGAACTGG - Intronic
956749806 3:72336636-72336658 TCCTCTCTATTTTAAAGAAGAGG + Intergenic
958774894 3:98470146-98470168 TGATCCTTATATCAATGAACTGG + Exonic
960155240 3:114291942-114291964 CCCTCCTTATCTGATAGAACAGG - Intronic
960417082 3:117397923-117397945 TCCTGGTTATTTCAAGGAAGTGG - Intergenic
962244171 3:133777476-133777498 TCCATCTTATTTCTAAGAAAAGG + Intronic
964225590 3:154396858-154396880 ATCTCCTTATTTTAAAGAAAGGG + Intronic
966118438 3:176493746-176493768 GCCTTCTTATTTGAAACAACAGG - Intergenic
970180091 4:13383066-13383088 ATCTCCTTATTTACAAGAACAGG + Intronic
970209700 4:13696592-13696614 TCCTCCTTCCTTCAAAAAATTGG - Intergenic
970546347 4:17134100-17134122 TTCTTCTGATTTCAAAGAAGGGG + Intergenic
971060632 4:22964845-22964867 TCCTCCTCTTTTCAAAAAGCTGG - Intergenic
971772602 4:30916496-30916518 TCTTCATAATTTCAAAGAGCTGG + Intronic
971839259 4:31812309-31812331 TTATCCCTATTTCAAAGAAGAGG - Intergenic
972875769 4:43357862-43357884 ACCCCCTCATTTCAGAGAACAGG - Intergenic
975196400 4:71529720-71529742 TCCTCCTTTTTTTAATAAACAGG - Intronic
977498503 4:97806924-97806946 TTCTCCTTTTCTCAAATAACAGG + Intronic
978560199 4:110024988-110025010 TCTTCCATAATTCAGAGAACTGG + Intergenic
981007105 4:139886833-139886855 TCCTGTATATTTCAAAAAACAGG - Intronic
981067060 4:140497044-140497066 TCCTGCTTGTTTCAAAGATTAGG - Intronic
982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG + Intergenic
982386200 4:154805733-154805755 TTCTCTTTATTTCAAAGCAATGG - Intronic
984035796 4:174665959-174665981 TCATCCTTATTTTAAAGATGAGG + Intronic
984244646 4:177260504-177260526 TCATCCTTTTTTCACAAAACAGG - Intergenic
984501241 4:180562061-180562083 TCCTCCTTAGATCACAGAGCTGG + Intergenic
984631784 4:182068336-182068358 TCCTCATTATTTGCAAGAATGGG - Intergenic
987234630 5:15930306-15930328 TCCTCTTCATTTAAAAGAAATGG + Intronic
987342850 5:16953738-16953760 TCTTGCTTAATTCAAAGAACCGG - Intergenic
988306469 5:29499819-29499841 TTCTACATATTTCCAAGAACAGG - Intergenic
989414734 5:41160433-41160455 TCCCTCTCATTTCAGAGAACTGG - Intronic
990709829 5:58567995-58568017 TCCCCCTTACTTCAGAGAAAGGG + Intergenic
990885843 5:60592681-60592703 TGCTCCTAATTTCAAAGAGGAGG - Intergenic
991505817 5:67322948-67322970 TCCTCCTCATTTCAAAATATTGG + Intergenic
995204626 5:109465607-109465629 TCTTCCTTATCTCAAAATACAGG + Intergenic
996590820 5:125145615-125145637 TCCTCATTTTTTCAAACACCTGG + Intergenic
1000409622 5:160924357-160924379 TCCTCATTATTTTAAGGAAGAGG - Intergenic
1000412940 5:160952878-160952900 TCTTCCTTATTTTAAGGAAGAGG + Intergenic
1000538252 5:162506119-162506141 TCTTCCTTATGTCCAAGAAGAGG - Intergenic
1005366289 6:25080971-25080993 TCCTGGTGATGTCAAAGAACTGG + Intergenic
1005830842 6:29670103-29670125 GCCTCCTTATTTTCAATAACTGG - Intronic
1007255883 6:40528387-40528409 TCCTCCTCATGTTAAAGAGCTGG - Intronic
1009985917 6:70780872-70780894 ACATCCTTATTTCACAGAAGAGG - Intronic
1010044409 6:71424088-71424110 TCCTTCTTATTTCAACAACCAGG + Intergenic
1010814164 6:80336531-80336553 TCCTCCTTAATGCAAATTACTGG - Intronic
1010916284 6:81623149-81623171 TCCTTCTTATTTCACACAAATGG + Intronic
1012639467 6:101590999-101591021 TCCTCTTTATTTCATAGAAAAGG - Intronic
1012857529 6:104519980-104520002 TCCTCCTGATTTCACTAAACAGG - Intergenic
1016300467 6:142624797-142624819 TCCTTCTTATTTCACAGACATGG - Intergenic
1016596202 6:145804330-145804352 TCCTCTTTATGTCAAATAAGAGG + Intronic
1017307323 6:152934248-152934270 TCTTTCTTATTTTAAAGAAATGG + Intergenic
1017621794 6:156306847-156306869 TTCTCCTCATTTCACAGAACTGG + Intergenic
1018078826 6:160241029-160241051 TACTTCTTACTTCAAAGAAGGGG - Intronic
1019900105 7:4013835-4013857 CCTTCCTCATTTCAAAGAAGGGG + Intronic
1021669948 7:23025437-23025459 TCCTCCTAACATCACAGAACTGG - Intergenic
1021914883 7:25421555-25421577 TCCTCTTTTTTTCAAAGGAATGG + Intergenic
1027803754 7:82789361-82789383 TCTTCCATATTTGAAACAACAGG + Intronic
1028209527 7:88056198-88056220 TCCTCTTTACTTCATAGAAAAGG + Intronic
1030534636 7:110750523-110750545 TACTCCTTATTTCAAAGCAATGG + Intronic
1032116157 7:129119034-129119056 TCCGCATTACTTCAAATAACTGG + Intergenic
1032195036 7:129783574-129783596 TCCTCATTCTTTTAAAGAGCTGG - Intergenic
1032303300 7:130709591-130709613 TTCTCCTGATCTCAAAGCACAGG + Intergenic
1032964060 7:137075092-137075114 TCGTCCATATTTCCCAGAACAGG + Intergenic
1033283308 7:140021178-140021200 GCCTCCTTATTTTACAGAAGAGG - Intergenic
1033505155 7:141992398-141992420 GCCTCCTTATTTTACAGAAGAGG - Intronic
1033880291 7:145873164-145873186 TCTTGCATATTTAAAAGAACTGG - Intergenic
1033982162 7:147178672-147178694 TCCTCCATGTTTCAGAGACCCGG - Intronic
1038614962 8:29085193-29085215 ACCTGCTGATTCCAAAGAACAGG + Intronic
1039383397 8:37107115-37107137 TCATTCTTATTTCAAAGATAAGG + Intergenic
1039866975 8:41513373-41513395 TCTACCTTATTTAAAAGAAATGG - Intergenic
1040373867 8:46803791-46803813 TCTTCCTTCTTTCACAGGACAGG - Intergenic
1040845487 8:51833757-51833779 ACGTCATTATTTCAAAGGACTGG - Intronic
1041192926 8:55371654-55371676 TCCACTTTATTTAAAAGTACTGG + Intronic
1046173458 8:110543948-110543970 ACCTCCTTATCTCAGAGAACAGG + Intergenic
1046764218 8:118052321-118052343 TACTCTTTATTTCAATGAATAGG + Intronic
1046794345 8:118354467-118354489 TCCTCCTTATTTCTAAGCTCAGG + Intronic
1048595837 8:135864916-135864938 TCCTTCTTATTTAAAGGAACTGG + Intergenic
1051014443 9:12458584-12458606 TCCTGCATATTTCATAGAAAGGG + Intergenic
1053225714 9:36354510-36354532 TCTTGCTTATTTAAATGAACTGG - Intronic
1055938606 9:81627140-81627162 ACCTCCTTATCTCAAAGATGAGG + Intronic
1058794239 9:108482917-108482939 TTCTCCTTCATTCACAGAACAGG - Intergenic
1059165729 9:112074767-112074789 TCCTCCTTTTATAAAAGAAAGGG + Intronic
1059900613 9:118921351-118921373 TCCTCCTTTTTTCAAACAGAAGG + Intergenic
1060174795 9:121489660-121489682 GCTTCCATTTTTCAAAGAACTGG + Intergenic
1060437086 9:123603259-123603281 TCCTTTGCATTTCAAAGAACTGG - Intronic
1062482471 9:136758986-136759008 TACTCCTCATTTCAAAGATCAGG - Intergenic
1185570639 X:1132183-1132205 CCCTCCTTCTTTCATACAACAGG + Intergenic
1187190025 X:17025644-17025666 TTATCCTTATTCCAAAGCACAGG - Intronic
1187249338 X:17582781-17582803 TTATCTTTATTTTAAAGAACAGG - Intronic
1187854804 X:23626518-23626540 TCCTCCTTGCTTCAAACAAATGG + Intergenic
1188127920 X:26393512-26393534 TACTTCTTATTTCAAATAAATGG - Intergenic
1189047768 X:37611463-37611485 TCCTCCTTGTTTAAAATGACAGG - Intronic
1189361425 X:40355842-40355864 TTCTCCTGATCTCAAAGAAAAGG - Intergenic
1191791963 X:64980648-64980670 TCATCCTTATTTTACAGAAGAGG + Intronic
1192281515 X:69692118-69692140 TCTTCCTCATTTCAGAGAAAGGG - Intronic
1193100909 X:77610665-77610687 TCCTTTTTATTTCACAGAAATGG + Intronic
1194397938 X:93409161-93409183 TCTTCCAAATTACAAAGAACAGG - Intergenic
1194773722 X:97936910-97936932 TCATCCTTATGTGAAAGAGCCGG - Intergenic
1198073881 X:133176400-133176422 TCCTCCCTATTTCATAGCAGTGG + Intergenic
1199453683 X:148002747-148002769 TTCTCACTATTTTAAAGAACTGG - Intronic
1201356226 Y:13099473-13099495 TCCTCCTTTTTTCAATGATAAGG - Intergenic