ID: 917659087

View in Genome Browser
Species Human (GRCh38)
Location 1:177160248-177160270
Sequence TGGAGAAAACAGAAGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1113
Summary {0: 1, 1: 0, 2: 3, 3: 95, 4: 1014}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917659087 Original CRISPR TGGAGAAAACAGAAGAATGG GGG (reversed) Intronic
900701846 1:4053434-4053456 TGGTGAACACAGCAGGATGGGGG - Intergenic
901203706 1:7482004-7482026 TGGAGAAATCAGAACAGTGGTGG - Intronic
901361860 1:8708217-8708239 TGGAGATAACTGAATCATGGGGG + Intronic
901464104 1:9409821-9409843 TGGAGGACACAGAACAGTGGAGG - Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901684393 1:10935508-10935530 TGGAGCAAACAGATGATGGGTGG + Intergenic
902886796 1:19410918-19410940 GGGAGGAAACTGAGGAATGGAGG - Intronic
903119579 1:21206490-21206512 TGCAGAAAACAGATGAATCTTGG + Intergenic
903119825 1:21208446-21208468 TGCAGAAAACAGATGAATCTTGG + Intergenic
903730147 1:25487645-25487667 TGGAGTAAACAGAAAAATAAGGG - Intronic
904406995 1:30297921-30297943 TGGAGAATTCAGAAGGTTGGAGG - Intergenic
905054819 1:35084226-35084248 TTGAGAAAACAGAGGAAAGATGG - Intronic
905060667 1:35136767-35136789 GGGAGAAGAGAGAGGAATGGAGG + Intergenic
905118478 1:35663088-35663110 TGGAGAAAGGAGATGAGTGGGGG - Intergenic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
906039175 1:42774077-42774099 TGGAAAAAACAAAACAAGGGAGG - Intronic
906308484 1:44736676-44736698 TGAAGAAAACAAAAGAGTTGGGG - Intergenic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
906992796 1:50756476-50756498 TGAAGAAGACAGAAAAATGCAGG - Intronic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
908054780 1:60273090-60273112 AGGTGAAAATAGAAAAATGGAGG - Intergenic
908304029 1:62792396-62792418 TGTAGAAAAGAGAAGATTGGGGG + Intronic
908358411 1:63344505-63344527 TGGAGAAAATTGAGGAGTGGAGG - Intergenic
908770897 1:67594717-67594739 TGGAGAAAATTGAATCATGGGGG - Intergenic
908954270 1:69602198-69602220 TGGAGAAAACAGAAAGATTCTGG - Intronic
909003349 1:70245387-70245409 TGATGAGAACAGAAGAGTGGGGG + Intronic
909264164 1:73535642-73535664 AGCAGAAAACAGAAAAATGCAGG - Intergenic
910442976 1:87271892-87271914 TGCACAAAAAAGAAAAATGGAGG - Intergenic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
910977292 1:92920238-92920260 TGGAGATAAATGAATAATGGGGG + Intronic
911032379 1:93503323-93503345 TGGAGATAACTGAATCATGGGGG - Intronic
911105903 1:94131308-94131330 TGGAGAAAACAGAAGGAAAATGG + Intergenic
911140741 1:94499593-94499615 TGGAGAAAAGCAAAGAATGGCGG + Exonic
911538071 1:99124575-99124597 TGGAGATAACTGAATCATGGGGG - Intergenic
911575132 1:99567151-99567173 TGGATTAAACAGTAGAATGGAGG + Intergenic
911762044 1:101627543-101627565 TGGTGAAAGCAGAAGCAAGGGGG - Intergenic
911769025 1:101715494-101715516 TGGAAAAAAGAGAAGAATTCTGG - Intergenic
911808506 1:102243098-102243120 AGGAGAAAACAGAAGGGTTGGGG + Intergenic
911982018 1:104580139-104580161 TTGAGAAGACAGATGAATGTTGG - Intergenic
912327950 1:108786340-108786362 TGGAGATAACTGAATAATGGGGG - Intronic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
913312465 1:117514908-117514930 AGCAGAAAACAGCAGAATAGGGG - Intronic
913327451 1:117639229-117639251 TGGAGAAGACAGCTGAATTGGGG - Intergenic
913409653 1:118537180-118537202 TGGAGATAACTGAATCATGGAGG + Intergenic
913428647 1:118763904-118763926 TTGAGAAAGCAGAACAATGGTGG + Intergenic
913495438 1:119424065-119424087 TGAAGAAAAAAAAAAAATGGAGG + Intergenic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914453451 1:147813573-147813595 TTGAGAAAAATGAAGAAGGGAGG + Intergenic
915540388 1:156562272-156562294 TGGAGAATACATGAGGATGGGGG - Intronic
915794363 1:158712287-158712309 TAGAGAAAACAGAAGAAATTTGG - Intergenic
915890266 1:159766982-159767004 TGTAGAAAATAGTAGAATGGAGG - Intergenic
916208473 1:162338331-162338353 AGGAGAAAAGAGAATAATGGGGG - Intronic
916326027 1:163561039-163561061 AGGAGAAAGCATAAAAATGGAGG + Intergenic
916370774 1:164092155-164092177 TGGAGATAACTGAATCATGGGGG - Intergenic
916611379 1:166395247-166395269 GGGAGAAAAGAGAGGCATGGAGG + Intergenic
916727715 1:167537931-167537953 TGGAAAATACATAATAATGGGGG - Intronic
916941637 1:169684085-169684107 GGGAGAAAAGGGAGGAATGGAGG - Intronic
916958535 1:169865540-169865562 AGGAGCTAGCAGAAGAATGGAGG - Intronic
917380375 1:174399845-174399867 TGGAGATAACCGAATCATGGGGG - Intronic
917411903 1:174767999-174768021 TGGAGATAACCGAATCATGGGGG - Intronic
917424631 1:174901500-174901522 TGGAGATAACTGAATCATGGGGG - Intronic
917498148 1:175561437-175561459 TGAAGGGAACAGAAGAAAGGAGG - Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917896669 1:179496669-179496691 CGTAGAAAACAGAAAAATTGTGG - Intronic
918137514 1:181687404-181687426 TGGACAAGACAGAAGAAGTGTGG - Intronic
918224580 1:182469964-182469986 TAGAGAAAGAAGTAGAATGGTGG + Intronic
918480009 1:184968497-184968519 TGGAGGAAACAGGAGAAAGAGGG - Intronic
918681517 1:187361130-187361152 TAGAGAGGACAGAAGAATGTTGG + Intergenic
919445808 1:197703914-197703936 TGGAGAAAACTAAAGAAGAGAGG - Intronic
919531415 1:198725866-198725888 GGTAGAAAACAAAAGAAAGGAGG - Intronic
919706682 1:200682963-200682985 TTGAGAATCCAGAAGGATGGGGG + Intergenic
919753882 1:201054565-201054587 TGGAGAAAAGAGACGAAGGGAGG + Intronic
919908109 1:202092243-202092265 GGGACAAAACAGAAGCATTGTGG - Intergenic
919942363 1:202297174-202297196 TGGAGACATCAGAGGAGTGGAGG - Intronic
919975339 1:202607117-202607139 TGGAGAGGACAGAATTATGGGGG - Intronic
920061594 1:203230545-203230567 AAAAAAAAACAGAAGAATGGTGG + Intronic
920877426 1:209849633-209849655 TGGAGAAAGCAGAAGACCCGAGG - Intronic
921597802 1:217073812-217073834 GGGAGAGAAGAGAAGAAGGGAGG + Intronic
922002409 1:221493202-221493224 TGGAGATAATTGAATAATGGAGG - Intergenic
923055110 1:230420513-230420535 TGGAGATAACTGAATCATGGGGG + Intronic
923367552 1:233277648-233277670 TGGAGAAAACCAAAGAACGGGGG + Intronic
923509748 1:234640176-234640198 AGGAGAAAAAAAATGAATGGAGG - Intergenic
923892018 1:238226614-238226636 GGGAGAAAACTGAATCATGGGGG - Intergenic
923962647 1:239102610-239102632 GGGAGAAGAAAGAGGAATGGAGG - Intergenic
924162674 1:241249835-241249857 TTGAGAAGATAGAAAAATGGTGG + Intronic
924354351 1:243154478-243154500 TGGAGAAAAAAGGAGGGTGGTGG - Intronic
924830163 1:247585623-247585645 TGGAGAAAACAGAATGCTGTTGG + Intergenic
1062958326 10:1554580-1554602 TGGGGAAAGCAGGAGAATGAAGG - Intronic
1063233857 10:4091935-4091957 TGGAGTAAACTGAAACATGGAGG - Intergenic
1063986159 10:11505105-11505127 TAGAGATAACAGAAGAAAGGAGG + Intronic
1064074098 10:12255163-12255185 AGGAGAAAACAGAGGGAGGGTGG - Intergenic
1064196558 10:13248455-13248477 TGGAGATAACTGAATAATGAGGG - Intergenic
1064448371 10:15418063-15418085 GGGAGATAACTGAATAATGGGGG + Intergenic
1064555531 10:16543500-16543522 TGAAGAAAACAAAAGCAGGGAGG + Intergenic
1064581600 10:16798416-16798438 TGGAGATAACTGAATCATGGGGG + Intronic
1066271905 10:33832327-33832349 TTGAGAAAACATCAGAAGGGAGG - Intergenic
1066491471 10:35899014-35899036 TGGAGAAAACAGTGGGAAGGAGG + Intergenic
1066546172 10:36502936-36502958 TGGAGGAGACAGAGGAATCGAGG - Intergenic
1068235304 10:54226350-54226372 GGGAGATAACTGAATAATGGTGG - Intronic
1068283295 10:54904853-54904875 TGGAGAAAAGGGAAGAAGGTGGG + Intronic
1068478972 10:57564452-57564474 TGGAGAAAACTGAATCATAGGGG + Intergenic
1068571377 10:58633075-58633097 TGGAGATAACTGAATCATGGGGG + Intronic
1069112373 10:64463885-64463907 TGGAGATAATTGAAGCATGGGGG - Intergenic
1070146863 10:73780783-73780805 TGGAGAAAACAGGTTGATGGTGG + Intergenic
1070384236 10:75909876-75909898 TGGAGTAAGCAAAAGAATGCTGG + Intronic
1070419663 10:76224270-76224292 TGAAAAAAAAAAAAGAATGGGGG + Intronic
1070594513 10:77822866-77822888 TGGAAAACACAAAAGCATGGAGG + Intronic
1071965844 10:90851777-90851799 TGGAGATAACTGAATCATGGGGG + Intronic
1072042658 10:91623985-91624007 TGGAGATAACTGAATCATGGGGG + Intergenic
1072206005 10:93205727-93205749 TGGAGAAAAAAGCAAAAAGGAGG + Intergenic
1072808053 10:98437885-98437907 TGGAGATAACTGAATCATGGGGG + Intronic
1073120504 10:101119754-101119776 TGGAGCAAGCAGAAGAGTGAGGG - Intronic
1073620448 10:105041885-105041907 TGGGAAAAACATAAGGATGGTGG + Intronic
1073624002 10:105077395-105077417 TGGGGAAACCAGAAGGATGAAGG + Intronic
1074197912 10:111205612-111205634 TGGAAAAATCAGAAGAAGGAAGG - Intergenic
1074765395 10:116696343-116696365 TGGAGATAACTGAATCATGGGGG + Intronic
1075045852 10:119146206-119146228 TTGAGAGAAAAGAGGAATGGGGG + Intronic
1075281807 10:121145133-121145155 TGGAGATAACTGAATCATGGCGG - Intergenic
1075780951 10:125016756-125016778 TAGAGAAGAAAGAAGAGTGGAGG - Intronic
1075945763 10:126431893-126431915 TTGAGGAAACACAAGAGTGGAGG - Intronic
1075983090 10:126758266-126758288 TGGAACAAACAGAAAATTGGGGG - Intergenic
1076239169 10:128890657-128890679 TGGAGATAACCGAATCATGGGGG + Intergenic
1076275964 10:129198949-129198971 TGGAGGGAACAGAAGAAAGAGGG + Intergenic
1076436542 10:130449219-130449241 TAGAGAAAACAGAAAAAAGTTGG - Intergenic
1076564102 10:131386530-131386552 AGGAGAAGAGAGATGAATGGAGG + Intergenic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1077550889 11:3199808-3199830 TGGAGACAACCGAGGAATTGGGG - Intergenic
1077925220 11:6675075-6675097 AGGAGGAAACAGGAGAAGGGAGG + Intergenic
1077957556 11:7037399-7037421 TGGAAAAAAAAGACGGATGGGGG - Intronic
1078027381 11:7709951-7709973 TGAAGAAAACAGGAAAATAGGGG + Intergenic
1078060038 11:8037361-8037383 TCCAGAAAACAGAAGAATCACGG - Intronic
1078251316 11:9618927-9618949 TGGAGAGAACAGTAGGATGTAGG - Intergenic
1078663153 11:13303412-13303434 TGGAGAAAAATGAAGCAAGGAGG + Intronic
1078817010 11:14835364-14835386 TGAGGAAAACAAAAGAATGGGGG - Intronic
1078936396 11:15954775-15954797 TGGAGATAACTGAATCATGGAGG + Intergenic
1079032663 11:16997222-16997244 TGGAGCAGAGAGAAGATTGGAGG - Intronic
1079507292 11:21167673-21167695 TGGAGAATACTGAACAAGGGAGG - Intronic
1080206182 11:29732149-29732171 TGGAGATAATTGAATAATGGGGG - Intergenic
1081101679 11:39009688-39009710 TTGAGAAAATAGAAGAATGCAGG - Intergenic
1081360454 11:42171152-42171174 TGGAGAAGGCTGAAGAAAGGTGG - Intergenic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1082225095 11:49696214-49696236 TGGAGTATACAGTAGAATGATGG - Intergenic
1083054172 11:59803813-59803835 GGGAGATAACAGAAAAATGGAGG - Intergenic
1083078401 11:60065759-60065781 TGGAGAAAGCAAAAGATGGGAGG - Intronic
1083084919 11:60133132-60133154 TGGAGATAACTGAATCATGGGGG + Intergenic
1084167084 11:67380042-67380064 TGGAGAAAACAGAGGTGTGGAGG - Intronic
1084754429 11:71226187-71226209 TGGACTCAACAGCAGAATGGAGG + Intronic
1084826948 11:71738716-71738738 TGGAGAAGAAAGGGGAATGGAGG - Intergenic
1084909559 11:72377161-72377183 TGAACAAAGCAGAGGAATGGAGG + Intronic
1084939752 11:72606243-72606265 CGGAGAAAACAGCAGAGTTGTGG - Intronic
1085188271 11:74594892-74594914 TGGAGATAACTGAATTATGGGGG - Intronic
1085366712 11:75954184-75954206 TGGATAACACTGAAGATTGGAGG + Intronic
1086316890 11:85604574-85604596 TGAAGAAAACAGGAGAATTGAGG - Intronic
1086541920 11:87922975-87922997 AGGAGAAAATAAAAGAATAGGGG + Intergenic
1086641487 11:89162957-89162979 AGGAAAAAACAGATGAATGCTGG + Intergenic
1086749455 11:90472986-90473008 TGGAGGAAACTGAATCATGGTGG + Intergenic
1086798822 11:91144876-91144898 TGGAGATAATTGAATAATGGGGG - Intergenic
1087192895 11:95274467-95274489 TGGAGATAACTGAATGATGGTGG + Intergenic
1087435629 11:98113461-98113483 TGGAGACAAAAGATGAAGGGAGG - Intergenic
1087436568 11:98126300-98126322 TGGAGATAACTGAATCATGGAGG + Intergenic
1087442572 11:98205503-98205525 TGGAGATAACTGAATCATGGGGG - Intergenic
1087622215 11:100555152-100555174 TTGAGAAAACAGCAGAAGGAAGG + Intergenic
1088021840 11:105129798-105129820 TGGAGATAACTGAATCATGGGGG - Intergenic
1088024586 11:105162517-105162539 AGGAGTAGACAGAAAAATGGTGG - Intergenic
1088071838 11:105796558-105796580 TGGAGAAACCAGAACACTGATGG - Intronic
1089098891 11:115943315-115943337 TGGTGAAAAGAGAGGAAAGGGGG + Intergenic
1089409935 11:118232330-118232352 TGGAGAAAAAAGCAGAAAAGGGG - Intronic
1089593305 11:119559048-119559070 TGGAGATAACTGAATCATGGGGG - Intergenic
1089880350 11:121767474-121767496 TGGAGAAGACTGAATAATGAAGG + Intergenic
1090134392 11:124181981-124182003 TAGAGAAAACAAAAGAAAAGAGG - Intergenic
1090301678 11:125646909-125646931 ACAAGAAAACAAAAGAATGGGGG - Intronic
1090753629 11:129769412-129769434 TGGAGTATCCAGAAGAAGGGAGG + Intergenic
1090927097 11:131258939-131258961 GGGAGAAAAAGGAGGAATGGAGG + Intergenic
1091010024 11:131992550-131992572 ATGAGAAAACAGCAGAATTGAGG - Intronic
1091484307 12:869015-869037 TGGGGGAAACAGAAGAAAAGTGG - Intronic
1091834059 12:3572081-3572103 TTGAGAAAGAAGAAGAAAGGAGG - Intronic
1091985250 12:4905819-4905841 TGAACAAAACAGGAGAATGTGGG - Intergenic
1092102001 12:5891265-5891287 TGGAGAAAAGAAAACAATGGGGG - Intronic
1092206470 12:6617257-6617279 GGCAGAAAACACAAGAATGCAGG - Intergenic
1092776667 12:11949864-11949886 AGGAGAAACCAGAAGCAGGGAGG + Intergenic
1092801042 12:12167222-12167244 TTTAGAGAACAGAAGAATGAAGG - Intronic
1092855193 12:12666582-12666604 TGGAGAAGACAGAAACATGGAGG - Intronic
1092976477 12:13749938-13749960 TGGAGATAAGGGAAGAATGGAGG + Intronic
1093014924 12:14146037-14146059 TGGAAATAACAGAATCATGGGGG - Intergenic
1093036185 12:14334440-14334462 TGGAGAAGACAGATGAATCTTGG + Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1094254156 12:28401645-28401667 TGGAGATAACTGAATCATGGGGG - Intronic
1094699216 12:32852418-32852440 TGGAGAAAAGACTAGAAAGGCGG + Intronic
1095433932 12:42166951-42166973 ATAAGAAAACAGAAAAATGGTGG - Intronic
1095522360 12:43082607-43082629 AGAAAAAAACATAAGAATGGAGG - Intergenic
1095658073 12:44694989-44695011 TGAAAAAAAGAGAAGAAAGGAGG + Intronic
1095712465 12:45305389-45305411 TGGAGAAAACAAAACAGTGTGGG - Intronic
1096025592 12:48358402-48358424 TGGAGAAAACAGAACTAGGCTGG - Intergenic
1096410179 12:51371583-51371605 GGGAAAAAAAAGAAGAATGCAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096749411 12:53749116-53749138 GGGAGAGAACAGAAGAAAGATGG + Intergenic
1096761168 12:53843276-53843298 TGAAGAATACAGAATACTGGAGG + Intergenic
1096841623 12:54383405-54383427 TGGAGAGAAAGGGAGAATGGGGG - Intronic
1097156366 12:57015132-57015154 GGGAGAAAAGAGAAGAAGGAAGG + Intronic
1097694041 12:62760003-62760025 GGGAGAAGAAGGAAGAATGGAGG - Intronic
1097811583 12:64024885-64024907 TGGAGATAACTGAATCATGGGGG - Intronic
1098178013 12:67814100-67814122 TGGAGAAAATTGAATCATGGGGG - Intergenic
1098719403 12:73876772-73876794 TGGAGGAGACAGAGGCATGGTGG + Intergenic
1098919758 12:76292702-76292724 GGGAGAAGAAAGAGGAATGGAGG - Intergenic
1099011382 12:77295326-77295348 TGGAGAAATCAGAAGTAGGCAGG + Intergenic
1099348294 12:81531310-81531332 TTCAGAAAACTAAAGAATGGTGG + Intronic
1099350554 12:81563235-81563257 TGGAGATGCCAGAAGAAAGGGGG - Intronic
1099536205 12:83848179-83848201 AGGAGAAGACAGAAGTAGGGAGG - Intergenic
1100043714 12:90352803-90352825 TGGAGATAATTGAATAATGGGGG + Intergenic
1100208999 12:92381875-92381897 AGGAAAAAAGAGAGGAATGGAGG + Intergenic
1100337418 12:93644500-93644522 TGGAGACAACTGAACCATGGGGG - Intergenic
1100739885 12:97580508-97580530 TGGAGATGACAGAAGATTGAGGG + Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1101076030 12:101130727-101130749 TGGAGATAACTGAATCATGGGGG - Intergenic
1101382395 12:104225502-104225524 TGGAGATAACTGAATCATGGGGG + Intronic
1101485219 12:105150937-105150959 TGGAGATAACTGAATCATGGGGG - Intronic
1101521896 12:105491484-105491506 AGAAGTATACAGAAGAATGGTGG - Intergenic
1101541072 12:105665917-105665939 TGGAGTAACCAGAAGAGAGGAGG + Intergenic
1101565578 12:105901885-105901907 TGGAGATAACTGAATCATGGGGG + Intergenic
1102272963 12:111555405-111555427 TGGAGATAACTGAATCATGGGGG + Intronic
1103012276 12:117466454-117466476 AGGAGAAAACAGCAGAAATGGGG + Exonic
1103040850 12:117694252-117694274 TGGAGATAACTGAATCATGGGGG + Intronic
1103063479 12:117877688-117877710 TGGATAAAACACAAGGAGGGAGG + Intronic
1103260609 12:119585223-119585245 TCGAGAATGGAGAAGAATGGAGG - Intergenic
1103336108 12:120190995-120191017 ATGAGAAAACTGAAGATTGGGGG - Intronic
1103814622 12:123644122-123644144 GGTAGAAAACAGAACACTGGTGG - Intronic
1103839002 12:123847596-123847618 TGAACAGAACAGAAGGATGGAGG - Intronic
1103839010 12:123847662-123847684 TGAACAGAACAGAAGGATGGAGG - Intronic
1104141995 12:125996417-125996439 TGGAGACACCAGCAGAATTGTGG - Intergenic
1104441145 12:128794358-128794380 TGGAGAAAACAAAAGGAAAGCGG + Intronic
1104477083 12:129079589-129079611 TCGAGAAAGCAGGAGAATGGAGG - Intronic
1105032023 12:132890586-132890608 TGGAGAAGAGGGAGGAATGGAGG - Intronic
1105645416 13:22312736-22312758 TGGAGAAAACAGAAATAATGAGG - Intergenic
1106509002 13:30396949-30396971 TAGAGACAACAGCAGAATGGTGG - Intergenic
1106746438 13:32713706-32713728 TGGAGAAGACAGTAGAATAATGG + Intronic
1106760726 13:32864996-32865018 TGGAGATAACTGAATCATGGGGG - Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1106947956 13:34849565-34849587 TGGAGAATAAAGCATAATGGAGG - Intergenic
1107132259 13:36909629-36909651 TGAATAAAACACAAGAATGGAGG + Intronic
1107250281 13:38351278-38351300 TGGAGAAAATAACAGACTGGAGG + Intronic
1107364070 13:39651303-39651325 TGGAGAAAAGAAAAGAAAGCAGG - Intergenic
1107380005 13:39846843-39846865 TGGACAAAGCAGAAAAAAGGTGG + Intergenic
1107527990 13:41252448-41252470 AGGAGAAGACAGTAGAAAGGAGG - Intronic
1107938441 13:45364280-45364302 TGGAGAAAGCAGGAGCAGGGAGG - Intergenic
1108086428 13:46797665-46797687 GGGAGAAAACAGAAAACTGATGG - Intergenic
1108327595 13:49348832-49348854 TGGAGAAGACCAAAGAGTGGTGG - Intronic
1108452263 13:50578948-50578970 TGGGGAAAACCAAAGAATGATGG + Intronic
1108512296 13:51167349-51167371 TGGACAAGTCAGAAGAAGGGGGG + Intergenic
1108580877 13:51827245-51827267 GGGAAAGAACAGAGGAATGGGGG + Intergenic
1108709384 13:53017700-53017722 TGGAGAAAAAAAAAGAAGTGTGG - Intergenic
1108885278 13:55173578-55173600 TGGTAAAAGCAGAAGAGTGGTGG + Intergenic
1108936878 13:55892219-55892241 TGAAGAAGACAGAAAAATGTTGG - Intergenic
1109315866 13:60748430-60748452 TGGTGACAACAGAAGTATTGTGG + Intergenic
1109474770 13:62865049-62865071 TGAGGAAAACAGAAAACTGGAGG + Intergenic
1109629869 13:65032688-65032710 TGGAGATAACTGAATCATGGGGG - Intergenic
1110293524 13:73835502-73835524 GGAAGAAGACAGAAAAATGGAGG + Intronic
1110351502 13:74513587-74513609 TGGAGATAACTGAATCATGGGGG + Intergenic
1110492500 13:76125329-76125351 TGGAGATAACTGAATCATGGGGG + Intergenic
1110667131 13:78130281-78130303 TGAAGATAACAGAAAAATGCTGG - Intergenic
1110725487 13:78817847-78817869 GGGAGAAAAAGGAAGAAAGGTGG + Intergenic
1110765329 13:79275403-79275425 TGGAGAAGAAGGAGGAATGGAGG - Intergenic
1110915783 13:81019086-81019108 TGAAGAAAACAGGAGAAAAGAGG - Intergenic
1111256152 13:85671368-85671390 TTGAGAAAATAGAAGAAAGTGGG + Intergenic
1111536681 13:89611100-89611122 TGGAGAAAACAGAATTATTTAGG - Intergenic
1111738053 13:92166773-92166795 TTGAGAAGACTGAATAATGGTGG + Intronic
1112301077 13:98231060-98231082 TGGAGATAACTGAATTATGGGGG - Intronic
1113257664 13:108524371-108524393 TGGCGAAAACAGAAGAGAGAGGG - Intergenic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113451170 13:110410975-110410997 AGGAGAAAAGGGCAGAATGGTGG - Intronic
1113712863 13:112481425-112481447 TGGAAAGAAAGGAAGAATGGCGG - Intergenic
1114650494 14:24281461-24281483 AGGAGACAGCAGGAGAATGGGGG + Intergenic
1114703992 14:24707128-24707150 TCGAGAAAGCAGAAGAACAGGGG + Intergenic
1114809265 14:25877251-25877273 TTCAGAAAAAAGAAGAATGTTGG - Intergenic
1114820782 14:26016952-26016974 AAGAGAAAACAGAAAAATGTAGG + Intergenic
1114853900 14:26414418-26414440 AGGAGAAAATAGAAGCATAGAGG - Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115133443 14:30080628-30080650 TGGAAAACACAAAACAATGGAGG - Intronic
1115140442 14:30164807-30164829 TGGAGAAAACATCAGAAATGGGG + Intronic
1115374942 14:32664435-32664457 TAGAGAAAACTGAAGAATATTGG + Intronic
1116278818 14:42874220-42874242 GGGAGAACTAAGAAGAATGGAGG - Intergenic
1116602775 14:46948453-46948475 GGGAGAAAACTGAAGAGTAGAGG - Intronic
1116610062 14:47057668-47057690 TGGAGAGGAGAGAAGAAGGGAGG - Intronic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117669276 14:58090018-58090040 TGTGTAAAACAGAGGAATGGAGG - Intronic
1117769786 14:59121767-59121789 TGGAGAAAAGAGCAGAAAGCTGG + Intergenic
1117874818 14:60241105-60241127 TGGAGAGAGCAGGAGAATGGAGG + Intergenic
1117962740 14:61178988-61179010 TGGAGACAACAGAGGAAATGGGG + Intergenic
1118046678 14:61977768-61977790 TGAAAAAAATAGGAGAATGGAGG + Intergenic
1118147492 14:63156416-63156438 TGGGGAAAAAAGAACGATGGGGG - Intergenic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118766813 14:68915415-68915437 TGGAGAAAACCAAAGCAGGGAGG - Intronic
1118898847 14:69969926-69969948 TGGAGAAAAGAGAAGAAAGTGGG + Intronic
1119007227 14:70942880-70942902 TGGAGATAACTGAATCATGGGGG + Intronic
1119113770 14:71999414-71999436 AGGAGAAATCAGAAGTATGATGG + Intronic
1119915478 14:78397425-78397447 TGGGCACAACAGCAGAATGGAGG - Intronic
1119992548 14:79215658-79215680 GGGAGATAACTGAATAATGGGGG - Intronic
1119994790 14:79241557-79241579 TGGAGATAACTGAATCATGGGGG - Intronic
1120117763 14:80640524-80640546 TGGAAAAAATAGAAAAATTGAGG - Intronic
1120442464 14:84558136-84558158 GGGAGAAAATAGAATCATGGGGG - Intergenic
1120498696 14:85267217-85267239 TGGAGATAACTGAATTATGGGGG + Intergenic
1120720906 14:87888909-87888931 TGGAGATAAGAGAAGAAAAGGGG + Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121288853 14:92758031-92758053 TGGAGATAACTGAATCATGGGGG + Intergenic
1121394596 14:93609061-93609083 AGGAGAGAAAAAAAGAATGGAGG - Intronic
1121591996 14:95122278-95122300 TGCAGAAAACAGGAGGAAGGCGG + Intronic
1123844063 15:24279550-24279572 TGGACAAAACTGAATCATGGGGG - Intergenic
1123859141 15:24445835-24445857 TGGACAAAACTGAATCATGGGGG - Intergenic
1124271226 15:28282551-28282573 TGGACACAGCAGTAGAATGGAGG + Intronic
1124490995 15:30155460-30155482 TGGAGAGGACAGAATTATGGGGG - Intergenic
1124550032 15:30671907-30671929 TGGAGATAACTGAATCATGGGGG - Intronic
1124723797 15:32136734-32136756 TGAAGAAAACAGGAGAAGGCCGG + Intronic
1124752541 15:32382871-32382893 TGGAGAGGACAGAATCATGGGGG + Intergenic
1125309722 15:38365575-38365597 TTCAGAAAAAGGAAGAATGGTGG - Intergenic
1125405630 15:39350393-39350415 TGTAGAAATCAGAATCATGGAGG - Intergenic
1125879661 15:43183100-43183122 TGGAGAAATCAGGTGAATGGTGG - Intronic
1126454341 15:48844701-48844723 TGGAGATAACTGAATCATGGGGG + Intronic
1126509195 15:49448236-49448258 TAGAAAAAACAGAAGAGTTGGGG - Intronic
1126522373 15:49610612-49610634 TATAGAAAACAGAAAAAAGGTGG - Intronic
1126539048 15:49802277-49802299 GGGAAAAAAAAGAAGAAAGGAGG + Intergenic
1126975349 15:54172072-54172094 TGGAGATAAGAGTAGAATGATGG + Intronic
1127245048 15:57163991-57164013 TGCAAAAAACAGAAGATTGTGGG + Intronic
1127715940 15:61649577-61649599 TGGAAAACACAGAAGAACGAAGG - Intergenic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1127942129 15:63709421-63709443 TGGGGACAACAGATCAATGGAGG - Intronic
1128534036 15:68476854-68476876 TGGAGAAACCAGGAGCAAGGAGG - Intergenic
1128659866 15:69490976-69490998 CGGAGAAAACAAAAGAATAAGGG + Intergenic
1128864788 15:71106313-71106335 TGGAGAATACTCAGGAATGGTGG - Intronic
1128896387 15:71377468-71377490 TGGAGAAAAAAGTAGAATCAGGG + Intronic
1128964049 15:72039912-72039934 TGGAGATCACAGAGGAACGGAGG - Intronic
1129372711 15:75107986-75108008 GTAAGAAAACAGAAGAATGATGG + Intronic
1129902918 15:79165468-79165490 TGGGGAAATGAGGAGAATGGGGG + Intergenic
1129942578 15:79511101-79511123 TGGAGAAAAGGAAAGAATCGAGG - Intergenic
1130036480 15:80365964-80365986 TGGAGCAACCAGTAGAATGGGGG + Intronic
1131222218 15:90594519-90594541 TGGAGGAAGGAGAAGAAAGGCGG + Intronic
1131353202 15:91720363-91720385 AGGAGAAGACAGAAGAAAGTGGG + Intergenic
1131357607 15:91758991-91759013 AGGAGAAAATAGAAGCATGAGGG + Intergenic
1131407792 15:92180604-92180626 TGGAGATAACTGAATCATGGGGG - Intergenic
1131407931 15:92181953-92181975 TGGAGATAACTGAATCATGGGGG - Intergenic
1131805292 15:96115640-96115662 TGGAAAGAACAGAAGAAGGAAGG + Intergenic
1131900225 15:97079849-97079871 TGGAGAAAACTCAGGAACGGGGG - Intergenic
1131976871 15:97955638-97955660 TGGAGATAACTGAATCATGGGGG + Intergenic
1132322959 15:100940269-100940291 TTTAGAAAAAAGAAGAATGAAGG - Intronic
1132413027 15:101599633-101599655 TGGGGTCAACAGCAGAATGGAGG - Intergenic
1133449004 16:5887702-5887724 TGTAAAAAACAGGAGAAAGGAGG - Intergenic
1133486224 16:6221838-6221860 TGGAGAAAACTGGATCATGGGGG - Intronic
1134582823 16:15385735-15385757 TGGAGACAACAGAACTCTGGTGG - Intergenic
1134845447 16:17435999-17436021 TGGAGATAACTGAATCATGGGGG + Intronic
1135314151 16:21429805-21429827 TGGAGACAACAGAACTCTGGTGG - Intronic
1135367074 16:21862084-21862106 TGGAGACAACAGAACTCTGGTGG - Intronic
1135444740 16:22509077-22509099 TGGAGACAACAGAACTCTGGTGG + Intronic
1135507225 16:23049492-23049514 TGGAGAAAACTGAATCATGGGGG + Intergenic
1135616466 16:23914939-23914961 TGGAGAAAACAGAAGCACCCAGG - Intronic
1136083686 16:27869231-27869253 TGGAGAGAACAGAAGAAGGAGGG + Intronic
1136125807 16:28179549-28179571 TGGAGGAAACAGAAGCATCAAGG - Intronic
1136193462 16:28633623-28633645 TGGAGACAACAGAACTCTGGTGG + Intergenic
1136287062 16:29250571-29250593 GGGAGAAAACTGAACCATGGGGG + Intergenic
1136310818 16:29408512-29408534 TGGAGACAACAGAACTGTGGTGG - Intergenic
1136324262 16:29510291-29510313 TGGAGACAACAGAACTCTGGTGG - Intergenic
1136438947 16:30250273-30250295 TGGAGACAACAGAACTCTGGTGG - Intronic
1137309753 16:47243631-47243653 TGGAGGTATCAGAAGAATGAGGG + Intronic
1137960441 16:52876974-52876996 TTGAGACCACAGAAGAATAGGGG + Intergenic
1138585950 16:57970648-57970670 AGGAGGAAAAAGAAAAATGGGGG - Intronic
1138770820 16:59661413-59661435 TGGAGATAACTGAATCATGGGGG - Intergenic
1138810330 16:60141471-60141493 TTGAAAAAAAAGAAGGATGGAGG + Intergenic
1139039374 16:62983595-62983617 GGGAGAAAAAGGAGGAATGGAGG + Intergenic
1139165691 16:64562688-64562710 GGGAGAAAATATAAGAATTGGGG + Intergenic
1139206040 16:65029572-65029594 TTCAGATTACAGAAGAATGGTGG + Intronic
1139324335 16:66140343-66140365 TGGAGAAAACAGACCACTCGTGG + Intergenic
1139395385 16:66634565-66634587 TGGACAAAACAGAATTAAGGGGG + Intronic
1139858498 16:70000891-70000913 TGGAGACAACAGAACTCTGGTGG - Intergenic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1140252603 16:73307333-73307355 TGGAGAAGCCAGAAAAATGTTGG + Intergenic
1140384364 16:74521542-74521564 TTGAGCAACCAGAAGAATAGAGG + Intronic
1140602491 16:76494076-76494098 TGGAAAAAAAAAAAGTATGGAGG - Intronic
1140684120 16:77416437-77416459 TGGAGATAACTGAATCATGGGGG + Intronic
1141433006 16:83980610-83980632 CCGAGAAAACAGAACAAGGGTGG + Intronic
1141642970 16:85352220-85352242 TGGAGAAAGCATAACAATGCAGG + Intergenic
1142092666 16:88223203-88223225 GGGAGAAAACTGAACCATGGGGG + Intergenic
1142468945 17:151894-151916 TAGAGAAAACAGCAGAACAGAGG - Intronic
1143095856 17:4477887-4477909 TGGGGAAAACAGAGGAGGGGTGG + Intronic
1143614402 17:8040883-8040905 TGGAGATAACAGAGGAGTTGGGG + Intronic
1144256851 17:13476812-13476834 TGGAGAAGAGAAAAGAAAGGAGG + Intergenic
1144386883 17:14756201-14756223 TGGAGAAAAGAAAGGAAGGGGGG - Intergenic
1144387100 17:14758906-14758928 TGGAGAAAACAAAGGAAGGGGGG + Intergenic
1144877471 17:18408472-18408494 TGGAGAAAAAAAAACAATGTTGG + Intergenic
1145916577 17:28577402-28577424 TGGTGAAAGCAGAGGAAGGGAGG + Intronic
1146514974 17:33482081-33482103 TGGAGCAAAGAGAGGACTGGAGG - Intronic
1147471172 17:40663138-40663160 AGAAGAAAACAGAAAAATGCTGG + Intronic
1147894123 17:43739412-43739434 TGGAGCAGGCAGAAGAATGCAGG + Intergenic
1148433287 17:47660831-47660853 GGGAGGAAACAGAAAAATGTAGG - Intronic
1148574700 17:48701559-48701581 TGGACTAAACAGTAGAATGGAGG - Intergenic
1148919270 17:51015709-51015731 TGGAAAAAAAAAAAGAATGAGGG + Intronic
1149027894 17:52051056-52051078 AGGGGAAAAATGAAGAATGGAGG + Intronic
1149076849 17:52605854-52605876 TGGAGATAACTGAATCATGGTGG - Intergenic
1149249506 17:54752325-54752347 TGGAGAAAATAAAAGAATAAAGG - Intergenic
1149402807 17:56315972-56315994 TGGAGAAGAAAGAAGAACAGAGG - Intronic
1150008041 17:61481708-61481730 TGGAGAAAACAGGAGGAGGGAGG + Intronic
1150346085 17:64405771-64405793 TGGGGACAACAGAAGGATGAAGG + Intronic
1150628618 17:66859876-66859898 TGGAGAAGAAGGAAGAAGGGAGG - Intronic
1150638897 17:66936220-66936242 TAGAGACAAAAGTAGAATGGTGG - Intergenic
1151129795 17:71884767-71884789 TGGAGATAACTGAATCATGGGGG + Intergenic
1151255580 17:72873854-72873876 TGGAGATAACTGAATCATGGGGG + Intronic
1151450302 17:74194668-74194690 AGAAGAAAACAGAAGAAAGAAGG + Intergenic
1151451783 17:74202641-74202663 TGGAGATAAAATAAAAATGGAGG + Intergenic
1151794696 17:76336050-76336072 TGGAGAACACAGCACAAGGGAGG + Intronic
1152654019 17:81511721-81511743 TGGAGAAAAGAAAAGAACGCAGG + Intronic
1152806359 17:82358502-82358524 TGCAGAACACAGATGAATCGGGG + Intergenic
1153098645 18:1438668-1438690 TGGAGAAGCCAGAAGAAGGATGG + Intergenic
1154077072 18:11213919-11213941 TGGAGAAAATAGAAGAGAAGTGG + Intergenic
1154212999 18:12395909-12395931 TGAGAAGAACAGAAGAATGGAGG + Intergenic
1154365899 18:13708770-13708792 TGGAGAAAAGAAGGGAATGGAGG - Intronic
1155230071 18:23764218-23764240 GGGAGACAAATGAAGAATGGTGG - Intronic
1155256541 18:24002720-24002742 TGTAGAAAAAAGCAGAATCGTGG + Intronic
1155679569 18:28473411-28473433 TAGAGAAGACAGAAAAATGTGGG + Intergenic
1155965045 18:32027876-32027898 TTGAGGTTACAGAAGAATGGGGG + Intronic
1156190837 18:34718647-34718669 TGGAAAATGCAGAAAAATGGTGG + Intronic
1156322230 18:36037661-36037683 TGAAGAAAACAGAAAGATGTGGG + Intronic
1156358714 18:36364894-36364916 GGGAGAAAGCAGAAGGGTGGTGG + Intronic
1156598075 18:38570835-38570857 TGGAAAGAACAGAAGAAGGAGGG + Intergenic
1156917818 18:42482419-42482441 TGATGACCACAGAAGAATGGAGG - Intergenic
1157684028 18:49628684-49628706 AGGAGGTAAGAGAAGAATGGTGG + Intergenic
1158067860 18:53434884-53434906 GGGAGAAATAAAAAGAATGGAGG + Intronic
1158422535 18:57308373-57308395 AGAAGCAAACAGTAGAATGGTGG + Intergenic
1158447545 18:57534180-57534202 CCCAGAAAACAAAAGAATGGAGG + Intergenic
1158665087 18:59425317-59425339 TGGAGATAACTGAATCATGGGGG + Intergenic
1159064947 18:63559407-63559429 TGGGAAGAACAGAGGAATGGAGG - Intronic
1159164325 18:64682903-64682925 GGGAGAAGAAGGAAGAATGGAGG - Intergenic
1159204680 18:65233856-65233878 TGGAGATAACTGAATCATGGGGG + Intergenic
1159286913 18:66365731-66365753 TGGAGATAATTGAAGCATGGGGG - Intergenic
1159432077 18:68365370-68365392 TTGAGAAAACAGAAAATTCGAGG - Intergenic
1159498939 18:69243306-69243328 TGGAGATAACTGAATCATGGGGG - Intergenic
1159523557 18:69558089-69558111 TGGAGAAAAAAGAATAATAAAGG - Intronic
1159555363 18:69940021-69940043 TGGAGATAACTGAATCATGGGGG + Intronic
1159671683 18:71227915-71227937 TGGAGATAACTGAATCATGGGGG - Intergenic
1160042042 18:75354007-75354029 TGGCAAAAACAGTACAATGGGGG - Intergenic
1160153066 18:76409903-76409925 TGGAGATAACTGAATCATGGGGG + Intronic
1162082247 19:8225171-8225193 TAGAGAAAACAGCAGAGAGGAGG + Intronic
1162848327 19:13411366-13411388 TGGAGATAACTGAATCATGGGGG + Intronic
1163883104 19:19944633-19944655 TGGAGAAACCAGAGGACTGGAGG - Intergenic
1164250314 19:23469858-23469880 TGGAGAAAAAAAAAGAGAGGAGG - Intergenic
1164486545 19:28660902-28660924 GGGAGAAAACTGAATCATGGGGG + Intergenic
1164756470 19:30693542-30693564 GGGAGAGAAGAGAAGAAAGGAGG + Intronic
1165271183 19:34709122-34709144 TGGGGAAAACAGTAGCAGGGAGG - Intergenic
1165286380 19:34846200-34846222 GGGAGAAAACAGAGGAATGATGG - Intergenic
1165510452 19:36263909-36263931 GGGAGAAAAAGGAGGAATGGAGG + Intergenic
1165914961 19:39252865-39252887 TGGAGGAAACAGATGAATTGTGG + Intergenic
1166018254 19:40000326-40000348 AGTAGAAAACAGAATAAGGGTGG + Intronic
1166425235 19:42671522-42671544 TGGAGAAACTAGAAGAATTCAGG + Intronic
1166425310 19:42672875-42672897 TGGAGAAACTAGAAGAATTCAGG - Intronic
1166513454 19:43427394-43427416 TGGTGAACACAACAGAATGGAGG - Intergenic
1166802180 19:45465155-45465177 TGGATGAGACAGAAGAATGAGGG + Intronic
1168491185 19:56811108-56811130 TGGAAAATACAGAAAAGTGGAGG - Exonic
925239675 2:2312839-2312861 TGGAGAAATGGGAAGAAAGGGGG + Intronic
925263756 2:2549978-2550000 TGGAGGATACTGAAGAATAGGGG + Intergenic
925593913 2:5536640-5536662 TGGAGAAAGAAGAGGAATGAAGG - Intergenic
925856683 2:8135723-8135745 TGGAGAAAAGAGAAACGTGGAGG + Intergenic
925879727 2:8342241-8342263 TCGAGGAAACAGAAAAATCGAGG + Intergenic
926280442 2:11441870-11441892 TGGAGAAAATTGAATCATGGGGG - Intergenic
926572698 2:14546916-14546938 AGGTAATAACAGAAGAATGGCGG + Intergenic
926602322 2:14858627-14858649 TGGAGATAACAGTAGAAGGATGG + Intergenic
926611778 2:14954790-14954812 TGGAGATAACTGAATCATGGGGG - Intergenic
926688229 2:15715006-15715028 TGGAGATAACTGAATCATGGGGG - Intronic
926817936 2:16819131-16819153 TGGAGAAAGCAGAAACAAGGGGG - Intergenic
927359280 2:22213548-22213570 TGGAGTAGAGATAAGAATGGTGG + Intergenic
928133438 2:28670151-28670173 TAGAGACAACAGTCGAATGGTGG + Intergenic
930280539 2:49363435-49363457 TGGAGAACACAGAAGAAGATAGG - Intergenic
930493127 2:52102052-52102074 TGGAGATAACAGAATCATGGGGG - Intergenic
930507242 2:52298847-52298869 TGGAGATAACTGAATCATGGGGG - Intergenic
930572604 2:53106292-53106314 TGGCAAAAACAAAAAAATGGGGG + Intergenic
931101776 2:59010529-59010551 TGGAGAAATCAGGTGAAGGGGGG + Intergenic
931493976 2:62782699-62782721 TGGAGATAACTGAATTATGGGGG - Intronic
931644680 2:64411279-64411301 TTGAGAAAAGAGAAGAAGGCAGG - Intergenic
931646949 2:64432378-64432400 TGAAGGAGACAGCAGAATGGAGG - Intergenic
931922643 2:67037749-67037771 TGGAGAGAACAGAAGACTTGGGG + Intergenic
932155984 2:69418096-69418118 GAAAGAAAACTGAAGAATGGGGG + Intronic
932218667 2:69983607-69983629 TGGAGGAATCTGAGGAATGGGGG + Intergenic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932492368 2:72130563-72130585 TCGAAAACACAGAAGAATGAAGG - Exonic
933275454 2:80279118-80279140 TGAAGAAGACAGAATAATGAAGG + Intronic
934572219 2:95379998-95380020 GGGAGAAAACAGAGGAAAGTGGG - Intronic
934702402 2:96452714-96452736 TGGAGATAGCAGAATTATGGGGG + Intergenic
934959657 2:98659573-98659595 TGGAGATAACTGAATCATGGGGG + Intronic
935330545 2:101974435-101974457 TGGAAAAGACAGAGGATTGGGGG + Intergenic
935342192 2:102068179-102068201 TGGAGATAACTGAATCATGGGGG + Intronic
936444693 2:112586380-112586402 TGGAGAAAAGAGATGAACTGAGG - Intronic
936652246 2:114441256-114441278 TGGAGAAATCAGGAGAATCATGG - Intergenic
936721172 2:115254351-115254373 TGGAGAAAATTGAATCATGGGGG - Intronic
937553938 2:123131255-123131277 GGGAGATAACTGAATAATGGGGG + Intergenic
937777978 2:125803794-125803816 TGGAGATAACTGAAGCATAGGGG - Intergenic
938196026 2:129329199-129329221 AGGAGCAAAGAGTAGAATGGTGG + Intergenic
938385828 2:130866383-130866405 TGGAAAAAAAAGAAGAAGGTGGG + Intronic
938811452 2:134856834-134856856 TGGAGCAAACAGAACAAAGCTGG - Intronic
938859292 2:135350301-135350323 AGGAGAAGAAAGAAGAATAGAGG + Intronic
939202125 2:139050503-139050525 TTGAGAGTACTGAAGAATGGTGG - Intergenic
939559025 2:143712076-143712098 TAGGGAAAACAGTAGAATGCTGG + Intronic
939837188 2:147144946-147144968 TGAAGACAAGAGAAGAATGAGGG + Intergenic
939871262 2:147528370-147528392 TGGAGATAATTGAATAATGGGGG - Intergenic
939873255 2:147548289-147548311 TTGAGAAGACAGAAGAATTCGGG - Intergenic
940166441 2:150778919-150778941 AGGAGAACACAGAATAAAGGAGG + Intergenic
940596316 2:155796981-155797003 TGGAGATAATAGAATCATGGGGG - Intergenic
940612918 2:156012694-156012716 AGGAGAAAACAGTAAAAAGGTGG - Intergenic
940888937 2:159015929-159015951 AGAAGAAGACAGAAGAATGTGGG - Intronic
941143230 2:161811429-161811451 AGGAGAAAATGGAAAAATGGAGG - Intronic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
942022499 2:171880740-171880762 TAGAGAAAATAGAATAATGATGG - Intronic
942149478 2:173060909-173060931 TGAAGAAAACAGAGGCAAGGGGG + Intergenic
942919248 2:181351259-181351281 GGGAGAAAAGAGAAGTGTGGAGG - Intergenic
942980601 2:182076502-182076524 TGTAAAAATCAGGAGAATGGAGG + Intronic
943333238 2:186585543-186585565 TGTATATAACAGAAGGATGGAGG + Intergenic
943559851 2:189447942-189447964 TGGAGATAACTGAATCATGGGGG + Intronic
943620377 2:190141598-190141620 TCAAGAAAACAGCAGCATGGGGG + Intronic
943708240 2:191059378-191059400 TGGAGAAAGCAAAAGAATAAAGG - Intronic
943978527 2:194514679-194514701 TATAGAATCCAGAAGAATGGTGG + Intergenic
944104199 2:196061716-196061738 TGGAGAAAAAGAAAGAATGGGGG + Intronic
944250881 2:197579358-197579380 GGGAGAAGAAAGAGGAATGGAGG - Intronic
944522224 2:200583907-200583929 TTCTGAAAACAGAAGAATGAAGG - Intergenic
945073249 2:206012194-206012216 TGGAAAATACAGAAGTATAGGGG + Intronic
945147515 2:206753747-206753769 AGCAGAAAAAAGAAAAATGGAGG - Intronic
945173309 2:207018493-207018515 GGGAGAAGAAAGAGGAATGGAGG - Intergenic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
945850826 2:215004447-215004469 AGAAGAAAAGAGAAGATTGGGGG + Intronic
945961193 2:216136493-216136515 TGGAGAAAAGAGAATAATCAGGG + Intronic
946027699 2:216681756-216681778 TGGGGGACACAGAAGCATGGTGG + Intronic
946108345 2:217391715-217391737 AGGAGAAAACAGGAAAATGTGGG - Intronic
946230100 2:218285997-218286019 TGGAGGCTAGAGAAGAATGGAGG + Intronic
946447961 2:219755662-219755684 TGGAGATAACTGAATCATGGGGG + Intergenic
946547193 2:220757048-220757070 TGGTGTGAGCAGAAGAATGGGGG - Intergenic
946769813 2:223077227-223077249 TGGAGACAACTGAATCATGGGGG - Intronic
946871916 2:224092313-224092335 GGGAGAAGAGAGAGGAATGGAGG + Intergenic
947094295 2:226548681-226548703 TGAAGAAAGTAGAAGAGTGGGGG - Intergenic
947246813 2:228057729-228057751 GGGACTGAACAGAAGAATGGTGG + Intronic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
948009264 2:234637498-234637520 TGGAGATAATTGAATAATGGGGG + Intergenic
948619310 2:239224159-239224181 TGCAGGAAACAGAAGAGTCGAGG - Intronic
949030173 2:241791978-241792000 AAAAGAAAACAGAAAAATGGGGG - Intronic
1169414465 20:5404129-5404151 AGAAGAAAACAGGAGAATGAGGG - Intergenic
1169415581 20:5413278-5413300 TGGAGATAATGGAATAATGGGGG + Intergenic
1169475238 20:5924948-5924970 TGGAAAATACAGAAAAGTGGAGG - Intronic
1169830872 20:9823443-9823465 TGGAGATAACTGAATCATGGGGG + Intronic
1169967773 20:11236651-11236673 TGGACAAAAAGGAAGAAAGGGGG + Intergenic
1170018712 20:11812289-11812311 TGGAGAAAAATGAAGACGGGAGG - Intergenic
1170083112 20:12498335-12498357 TGGAGAAAGCAGAAGAGGGTAGG - Intergenic
1170158202 20:13287374-13287396 TGGAGATAACTGAATCATGGGGG - Intronic
1170379780 20:15744616-15744638 TGAAGAAAACTGAAGAAATGAGG + Intronic
1170986163 20:21261053-21261075 TGGAGATAATAGAATCATGGGGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1173058486 20:39639078-39639100 TGCAGAAAACAAAAGTATGGTGG + Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1175044893 20:56095402-56095424 TGGAGATAACTGAATCATGGGGG - Intergenic
1175317365 20:58058466-58058488 TGGAGATAACTGAATCATGGAGG - Intergenic
1175616160 20:60400355-60400377 TTGAAAAAACAGAAAAATGCTGG - Intergenic
1175730727 20:61352170-61352192 TGGAGATAGGAGAAGAAAGGTGG - Intronic
1176671449 21:9738731-9738753 TGGAGACAACACAGGAATGAGGG - Intergenic
1176768877 21:13051670-13051692 AGGAGAAAACAAAAGTTTGGTGG + Intergenic
1177133343 21:17283300-17283322 TGGAGAAAACAGAACCAAGTTGG + Intergenic
1177145884 21:17406641-17406663 TGGAGATAATAGAATCATGGGGG - Intergenic
1177197699 21:17920095-17920117 AGAAGAAAACAGAAAAATGTGGG - Intronic
1177248255 21:18559060-18559082 AGTAGAAAACAGAAGAATGTTGG - Intergenic
1177380425 21:20334086-20334108 TGGGTAAAACAAAAGAATGGAGG + Intergenic
1177767248 21:25473013-25473035 AGAAGAAAACAGAAAAATGTGGG + Intergenic
1177918861 21:27125200-27125222 TGGAGATAACTGAATCATGGGGG - Intergenic
1177976204 21:27854245-27854267 TGGAGATAACTGAATCATGGGGG + Intergenic
1178048160 21:28719343-28719365 TGGAGATAACTGAATCATGGGGG + Intergenic
1178115735 21:29414475-29414497 TGGTGAAAACAGCAGAAAGAGGG - Intronic
1178173860 21:30074785-30074807 TGGAGATAATAGAATCATGGGGG + Intergenic
1178454349 21:32733471-32733493 TGGAGATAACTGAATCATGGGGG + Intergenic
1178935500 21:36858439-36858461 TACAGAAAACAGAAGATTGGGGG + Intronic
1179017096 21:37603377-37603399 TGGAGGAAACAGCTGACTGGGGG - Intergenic
1179052814 21:37903218-37903240 TGGAGATAACTGAATCATGGGGG + Intronic
1179311088 21:40196708-40196730 AGGAGAAAACAGAAAAAAGCAGG - Intronic
1179385547 21:40938480-40938502 GGGAGAAAACAGACAGATGGGGG - Intergenic
1179404709 21:41115762-41115784 AGGAGAGAGCAAAAGAATGGAGG - Intergenic
1179409591 21:41152443-41152465 TAGAGAAAACTGAATCATGGGGG - Intergenic
1179488610 21:41726586-41726608 AGGAGAAAGAAGAAGAAGGGGGG - Intergenic
1179822497 21:43944742-43944764 TGGGGAAAGCAGAAGAAAAGAGG + Intronic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181321444 22:22009992-22010014 TCTAGAAAACAAAAGGATGGGGG + Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181867092 22:25867308-25867330 TGGAGAATAAAGAATTATGGTGG - Intronic
1181936071 22:26439826-26439848 TGGAGGAGACAGAAGGACGGAGG - Intronic
1182727335 22:32458448-32458470 TGGAGAAAATAAAGCAATGGTGG - Intronic
1182887799 22:33790097-33790119 TGGAGATAACTGAATCATGGGGG + Intronic
1182957255 22:34438167-34438189 AGGAAAGAACAGAAGAATAGAGG + Intergenic
1183693366 22:39404042-39404064 TGGGGATGGCAGAAGAATGGTGG + Intronic
1184131882 22:42521399-42521421 GGGAGATAACAGAACGATGGTGG - Intergenic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1185178855 22:49347857-49347879 TGGAGGCATCAGAATAATGGAGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949462766 3:4311309-4311331 TGGAGACAAAATAATAATGGAGG + Intronic
949464276 3:4328586-4328608 TGGAGAAAATTGAATCATGGAGG - Intronic
949464545 3:4330557-4330579 TGGAGAAAACTGATTCATGGTGG - Intronic
949671012 3:6398926-6398948 GGGAGAAAAAGGAGGAATGGAGG - Intergenic
949935663 3:9113680-9113702 TGGAGATAACTGAATCATGGGGG + Intronic
950738801 3:15033184-15033206 TGTGGAAAACACTAGAATGGAGG + Intronic
951380480 3:21977891-21977913 TGGAGAAACGAGTAGAATGCAGG + Intronic
951765412 3:26192546-26192568 TGGAGAATGCAGTAGATTGGTGG - Intergenic
952239110 3:31511546-31511568 TGGAGATAACTGAATCATGGGGG + Intergenic
952524881 3:34199453-34199475 TGGAGCAAGCAGAAGAGTGAAGG + Intergenic
952548224 3:34446118-34446140 GGGAGATAACTGAAGCATGGGGG + Intergenic
952553428 3:34504642-34504664 TGGAGAACACAGAAGCAGGCAGG + Intergenic
952770660 3:36996992-36997014 TGGAGAAAACTAAAGCAGGGAGG + Intronic
952945064 3:38473522-38473544 TGGGGAAGAGAGAGGAATGGGGG + Intronic
953236654 3:41113082-41113104 TGAAGAATAGAGGAGAATGGAGG - Intergenic
953276287 3:41501877-41501899 AGAAGCAAACAGGAGAATGGTGG - Intronic
953837505 3:46359651-46359673 TGGGGAAAAGAGAAGAGTGAGGG - Intronic
954948987 3:54452342-54452364 TGGAGATAACTGAATCATGGGGG - Intronic
955006191 3:54970778-54970800 TGGAGCAGGCAGAAGCATGGTGG + Intronic
955015090 3:55062448-55062470 TGTAGAAAACAAAAAAAAGGAGG + Intronic
955253217 3:57304941-57304963 GGGAGAAAAAGGAGGAATGGAGG - Intronic
955537043 3:59934833-59934855 TGGAGAAAATTGAATCATGGGGG - Intronic
955634467 3:61011525-61011547 TGTATAAAGCAGAAGAATGAAGG - Intronic
955958284 3:64313059-64313081 TGGAGATAACTGAATCATGGAGG - Intronic
956325344 3:68046064-68046086 TGGAGATAAGAGAAAAATGAAGG - Intronic
956359112 3:68427783-68427805 TGGAGGTAACTGAATAATGGGGG + Intronic
956365125 3:68493173-68493195 TGGAGACAGAAGTAGAATGGTGG - Intronic
956501960 3:69896617-69896639 TTAAGAAAAAAGAAGATTGGGGG - Intronic
956505431 3:69933275-69933297 TAGAGAGAATAGAAGAATAGTGG + Intronic
956579004 3:70789328-70789350 TGGACACAACAGCAGAATGGAGG - Intergenic
956624108 3:71249779-71249801 GGGAGAAGACAGAAGAATAAAGG + Intronic
956901590 3:73721972-73721994 TGGAGAAAAATGGAGATTGGAGG + Intergenic
956925714 3:73986057-73986079 TGGAGATAACTGAATCATGGGGG - Intergenic
957017913 3:75091458-75091480 TGGAGACAACTGAATCATGGGGG - Intergenic
957282325 3:78169775-78169797 AGGAGAAAAAAGAAAAAGGGGGG - Intergenic
957313491 3:78548353-78548375 TGGAGATAACTGAATCATGGGGG - Intergenic
957454737 3:80426829-80426851 TGGAGATAACTGAATCATGGGGG + Intergenic
957541247 3:81572031-81572053 TGGAGATAACAGAATCATGGGGG + Intronic
957576385 3:82013989-82014011 TGGAGAACTCAGAAGAAGGTAGG + Intergenic
957944021 3:87038888-87038910 TGGAGAAGACAGAGGAATGATGG - Intergenic
958065220 3:88536151-88536173 TGGAGAAAATTGAATCATGGGGG + Intergenic
958160724 3:89814585-89814607 TGGAGAAAATTGAATCATGGGGG - Intergenic
958514840 3:95100929-95100951 TGGAGATAACTGAATCATGGGGG + Intergenic
958539601 3:95453885-95453907 TGGAGATAATTGAATAATGGGGG + Intergenic
958575217 3:95940793-95940815 TGGAAAAAACATGAGAATGCAGG + Intergenic
958604276 3:96338236-96338258 AGAAGAAAACAGAAAAATGAGGG + Intergenic
958871300 3:99562228-99562250 AGGAGAGAACAGAAGAAAGGAGG - Intergenic
959258317 3:104042896-104042918 TGGAGATAATAGAATTATGGGGG - Intergenic
959404490 3:105943456-105943478 AGGAAAAAAAAGAAGAAAGGAGG + Intergenic
959560353 3:107772746-107772768 TGGAGAAAACAGATGAAACTAGG + Exonic
959576424 3:107939222-107939244 TCAAGAAAACAGAAGAATAGGGG - Intergenic
959614799 3:108335298-108335320 TGGATGAAACAGCAGTATGGTGG - Intronic
959979550 3:112500240-112500262 TGGAGAAAACAGTCCTATGGTGG - Intergenic
959985970 3:112571789-112571811 TGGAGATAACTGAATCATGGCGG - Intronic
960208913 3:114936119-114936141 TGGAGGAAACACAATAATGGAGG + Intronic
960445930 3:117748741-117748763 TGGAGATAACTGAATCATGGGGG - Intergenic
960759945 3:121062605-121062627 TGGGGAGAACAGAAGAAAGTTGG - Intronic
961712915 3:128841001-128841023 GGGAGAAAAAGGAGGAATGGAGG + Intergenic
962894395 3:139700840-139700862 AAGAGAGAACAGAAGATTGGTGG + Intergenic
962908230 3:139824675-139824697 AGGAGAAAACAGAGGCCTGGAGG + Intergenic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963579194 3:147102796-147102818 AGGAGCAAAGAGTAGAATGGTGG - Intergenic
963639146 3:147837011-147837033 TGGAGAACAGAGAAGAGTGAAGG - Intergenic
964149251 3:153504542-153504564 TGGAGAAAACAGAAGAGCTCAGG + Intergenic
964487235 3:157198614-157198636 AGGAGAAAATAGAAAAATGATGG - Intergenic
964518555 3:157539561-157539583 TGCAGAAAAGAGACAAATGGTGG + Intergenic
964687474 3:159413157-159413179 TGAAGATAACTGAATAATGGGGG - Intronic
965107978 3:164382940-164382962 TGGAGTAAAAAGAAAAATGGGGG + Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965392257 3:168119097-168119119 TGGAGAAAACATGAGAATGCCGG - Intergenic
965403829 3:168247305-168247327 TGGATAACACACAAAAATGGTGG - Intergenic
965570671 3:170168824-170168846 TAGAGAAAAGAAAAGAATGCAGG + Intronic
965598736 3:170434104-170434126 TGGATACAACAGAAGATTGAAGG - Intronic
966026881 3:175294979-175295001 ATGAGAAAACAGAAGCATAGAGG - Intronic
967039052 3:185672683-185672705 TGGAGAAAAAAGATGAAGGGAGG + Intronic
967155169 3:186685227-186685249 AGAAGAAAACAGAAAAATGTGGG - Intergenic
967393895 3:188984969-188984991 AGGAGAAAAAAGAAGAAAGTGGG - Intronic
967615452 3:191559905-191559927 TGGAGATAACTGAATCATGGGGG - Intergenic
967821658 3:193844371-193844393 TGGAGAAATCAGAAAAATTAAGG - Intergenic
968520558 4:1032987-1033009 TGCAGAGGACAGAAGAATGAGGG + Intergenic
969075327 4:4573809-4573831 TGGAGCTCACAGAAGCATGGAGG - Intergenic
969748915 4:9095518-9095540 GGGAGAAGAAAGGAGAATGGAGG - Intergenic
969928607 4:10609174-10609196 TGGGGAAAAGAGAAGCAGGGGGG - Intronic
969932237 4:10641808-10641830 TGGAGATAATTGAATAATGGGGG + Intronic
970274445 4:14382873-14382895 AGGTGAAAGCAGAAGAATGTGGG - Intergenic
970365211 4:15351258-15351280 AGGAGAAAACAGAGGAAGGAAGG - Intronic
970368679 4:15386549-15386571 TGGAGAAAACAAAGAAAAGGGGG + Intronic
970492537 4:16589369-16589391 TGTAGAAAATAGAAGCATGGTGG + Intronic
970589015 4:17542834-17542856 TAGAGATAACAGAAGAATGAAGG + Intergenic
970739486 4:19217793-19217815 TGGAGAAAACTGAATCATGGGGG + Intergenic
970931440 4:21516939-21516961 TGGAGAATACCAAAGACTGGTGG + Intronic
971027534 4:22603224-22603246 TGGCTAAAACAGAAGAAAGAGGG + Intergenic
971112663 4:23606330-23606352 TGGAGATAACTGAATCATGGAGG + Intergenic
971460728 4:26892997-26893019 TGCAGAAAACAGATGAATTTTGG - Intronic
971543247 4:27849241-27849263 TGGATTAAACAAAAGAATAGAGG + Intergenic
971641156 4:29134891-29134913 TGGAACAACCGGAAGAATGGAGG + Intergenic
972014643 4:34227452-34227474 AGGAGACCTCAGAAGAATGGCGG - Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972268073 4:37482244-37482266 AGGAGAAGACAGAAAAATGTGGG + Intronic
972382800 4:38535266-38535288 TGGAGATAACTGAATCATGGGGG - Intergenic
972977334 4:44652513-44652535 TGGAGCCAACAGCAGAATGCTGG + Intronic
973104016 4:46309248-46309270 AAAAGAAAACGGAAGAATGGTGG - Intronic
973662210 4:53119735-53119757 TGTAGAAAACAGATAAATTGAGG + Intronic
973952942 4:56036033-56036055 TGGAGTAAACAGAAGACTGATGG - Intergenic
974166724 4:58213942-58213964 TTGAGAATACAGAAGGATTGGGG + Intergenic
974255028 4:59441562-59441584 TGGAGATAACTGAATCATGGGGG + Intergenic
974679175 4:65138366-65138388 TGGAGATAATTGAAGCATGGGGG - Intergenic
974846115 4:67352582-67352604 AGGAGAAGACAGAAAAATGTGGG - Intergenic
975227140 4:71886739-71886761 TGTAGTAGACAGTAGAATGGTGG - Intergenic
975273442 4:72465781-72465803 TGGAGATAACTGAATTATGGGGG + Intronic
975804449 4:78097686-78097708 TGGAGATAACTGAATGATGGGGG - Intronic
975925179 4:79442308-79442330 TGGAGATAATAGAATCATGGGGG + Intergenic
975932021 4:79536520-79536542 TGGAAAAAGGAGAGGAATGGTGG + Intergenic
975957319 4:79857021-79857043 TGGAGATAACTGAATCATGGGGG - Intergenic
975966822 4:79983877-79983899 TGGAGGAATTAAAAGAATGGAGG - Exonic
976104526 4:81602559-81602581 TGGAGAGATCAGAAGAGTGAAGG + Intronic
976205149 4:82617321-82617343 TGCAGAGAGCAGAAGTATGGAGG + Intergenic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976306137 4:83561129-83561151 TAGAGAAAACAGCACAATGGGGG + Intronic
976521645 4:86034880-86034902 TGTAGAAAACAGAATAGGGGTGG + Intronic
976727575 4:88229654-88229676 TGGGGAGAAAAGGAGAATGGTGG - Intronic
976935697 4:90629536-90629558 TGGAGATAACTGAATCATGGGGG - Intronic
977046301 4:92072297-92072319 AGGAGAAAACAGAAAGATGTGGG - Intergenic
977108023 4:92915195-92915217 TGAAGATAACTGAATAATGGGGG - Intronic
977545351 4:98370473-98370495 TGGAGAAAAAAGGAGAAAGGAGG - Intronic
978188894 4:105890796-105890818 TGGAGGAAAAGGAAGTATGGAGG - Intronic
978215876 4:106202323-106202345 ATAAGAAAACAGAAGAATGATGG + Intronic
978277387 4:106968106-106968128 TGGAGAAAAGAGAGGGAAGGAGG + Intronic
978394258 4:108261623-108261645 TGTAGAAAAGAGAAGAATCCTGG - Intergenic
979137404 4:117127271-117127293 AGAAGAAAACAGAAAAATGTGGG + Intergenic
979247453 4:118525167-118525189 TGGAGAAAAAAGGAGGGTGGTGG + Intergenic
979419141 4:120481644-120481666 TGGAGAAAAAAAAAAACTGGAGG + Intergenic
979515700 4:121607393-121607415 TGGAGAAAAAAGAACAAAGCTGG - Intergenic
979721360 4:123904423-123904445 TGGAGAACTCAGAAGAAGAGAGG + Intergenic
979772326 4:124543312-124543334 TGGCTAAAACAGAAGAAAGTTGG + Intergenic
979868714 4:125789385-125789407 TGCATAAAACAGAAAAGTGGGGG + Intergenic
979889479 4:126073045-126073067 AGGAGAGAACAGAGGAATGTGGG + Intergenic
980253808 4:130350339-130350361 AGGAGAAAACAGAGGAAAGAGGG - Intergenic
980368736 4:131839563-131839585 TGGAGAAGACTGAATCATGGGGG + Intergenic
980476799 4:133328843-133328865 TGGAGATAACTGAATCATGGGGG - Intergenic
980795225 4:137674025-137674047 TGCAGAAAACAACAGAATGGTGG - Intergenic
980847386 4:138340432-138340454 TGGAGAAAAGTGAAAAATGCTGG - Intergenic
980972564 4:139580832-139580854 TGGAGATAACTGAATCATGGGGG - Intronic
981246093 4:142540512-142540534 TGGAGAAAACAGAGAAATGAGGG - Intronic
981389676 4:144173828-144173850 TGGAATAAACAGAAGAGTGCAGG - Intergenic
982510874 4:156281752-156281774 TGGAGATAATTGAATAATGGGGG + Intergenic
982795120 4:159635202-159635224 TGGAGATAACTGAATCATGGGGG - Intergenic
982991858 4:162286424-162286446 TGGAGGAAGCAGAGGAATGAAGG - Intergenic
983049682 4:163031421-163031443 TGGAGTGAACAGAAGAACAGAGG - Intergenic
983393777 4:167167920-167167942 TGGAGAAAACTGAATCATGGGGG + Intronic
983585431 4:169349116-169349138 TTGACAAAACAAAATAATGGAGG - Intergenic
984323187 4:178220451-178220473 AGGAAAGAAGAGAAGAATGGAGG + Intergenic
984543701 4:181073389-181073411 TGGAGAAAAAAAAAGAAAGATGG - Intergenic
984949970 4:185000843-185000865 TGGAGAAAGGAGAAGAAAGGTGG - Intergenic
985403286 4:189613087-189613109 TGGAGACAACACAGGAATGAGGG + Intergenic
986515637 5:8560387-8560409 TTCAGAAAATAGAAGAAAGGGGG - Intergenic
986557790 5:9028279-9028301 TGGAGATAATTGAATAATGGGGG + Intergenic
986564543 5:9099137-9099159 TGGAGAGAAAAGAAAAATGATGG - Intronic
986683297 5:10252716-10252738 TGGATAAAACAGAATTATGCTGG - Intronic
986815809 5:11409091-11409113 TAGTAAAAACAGAAGTATGGGGG - Intronic
986842854 5:11717817-11717839 TGGAGATAACTGAATCATGGGGG - Intronic
987226089 5:15842651-15842673 TGGAGATAATAGAATCATGGAGG + Intronic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987297484 5:16566867-16566889 TGGAGAACTCAAAAGAATGCAGG + Intronic
987341398 5:16942611-16942633 TGGTGAGAACATAAGAATAGGGG - Intergenic
987422903 5:17741836-17741858 TGGAGATAACTGAATCATGGGGG - Intergenic
987708898 5:21485209-21485231 TGGAGATAACTGAATCATGGAGG - Intergenic
987745018 5:21959540-21959562 TGTAGAAAACAGAAAAAAGCAGG + Intronic
987831221 5:23098022-23098044 TGGGGAAGAAGGAAGAATGGAGG + Intergenic
987965328 5:24865049-24865071 TGGAGGAAACAGGAGATTGTGGG + Intergenic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988277836 5:29105695-29105717 TGGAGAAAAAAAAAAAATTGAGG - Intergenic
988293840 5:29329211-29329233 TGAAGATAAGACAAGAATGGAGG + Intergenic
988391290 5:30635987-30636009 TTGGGAAAACAAAAGAATGCTGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988750714 5:34188937-34188959 TGGAGATAACTGAATCATGGAGG + Intergenic
988810059 5:34776225-34776247 TGGAGATAAGAGCAGAATGATGG + Intronic
989198724 5:38742030-38742052 TGGAGATAACTGAATAATGGGGG + Intergenic
990022512 5:51145016-51145038 TGGAGATTACAGACTAATGGTGG - Intergenic
990497578 5:56363895-56363917 TGGAGATAACTGAATCATGGGGG + Intergenic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
990999039 5:61764433-61764455 TGGAGACAAGAAAAAAATGGGGG + Intergenic
991032576 5:62097915-62097937 TGGAGACAACTGAATCATGGGGG + Intergenic
991374544 5:65953107-65953129 TGGAGAAAGCAGAAGCAGAGAGG - Intronic
991735852 5:69630862-69630884 TGGAGATAACTGAATCATGGAGG + Intergenic
991738980 5:69652150-69652172 TGGAGATAACTGAATCATGGAGG + Intergenic
991759218 5:69904281-69904303 TGGAGATAACTGAATCATGGAGG - Intergenic
991765225 5:69969670-69969692 TGTAGAAAACAGAAAAAAGCAGG + Intergenic
991782098 5:70148483-70148505 TGTAGAAAACAGAAAAAAGCAGG - Intergenic
991788118 5:70213841-70213863 TGGAGATAACTGAATCATGGAGG + Intergenic
991790555 5:70231891-70231913 TGGAGATAACTGAATCATGGAGG + Intergenic
991812346 5:70486501-70486523 TGGAGATAACTGAATCATGGAGG + Intergenic
991815305 5:70506978-70507000 TGGAGATAACTGAATCATGGAGG + Intergenic
991818441 5:70528267-70528289 TGGAGATAACTGAATCATGGAGG + Intergenic
991838447 5:70779347-70779369 TGGAGATAACTGAATCATGGAGG - Intergenic
991844459 5:70844741-70844763 TGTAGAAAACAGAAAAAAGCAGG + Intergenic
991874541 5:71148798-71148820 TGTAGAAAACAGAAAAAAGCAGG - Intergenic
991880565 5:71214205-71214227 TGGAGATAACTGAATCATGGAGG + Intergenic
991883002 5:71232226-71232248 TGGAGATAACTGAATCATGGAGG + Intergenic
991976330 5:72186827-72186849 GGGAGACAAAAGAAGAAGGGAGG + Intronic
992872686 5:81022620-81022642 TGGAGAAAACAGAGGGAGGCAGG - Intronic
992951870 5:81866850-81866872 TGGAGAAAATAGTAGAATTTTGG + Intergenic
993092474 5:83443021-83443043 TGGGGAAAAGAGAAGAAAAGGGG - Intergenic
994151853 5:96456808-96456830 TGGAGATAACTGAATCATGGGGG + Intergenic
994439340 5:99783160-99783182 TGGAGAAGCCAGTAGAATGGAGG + Intergenic
994542486 5:101117833-101117855 TGGAGAGAAAAGATGAAAGGAGG - Intergenic
994622141 5:102176460-102176482 TAGAGAAAGCAAAACAATGGTGG - Intergenic
994686704 5:102963655-102963677 TGTAGAAAACAGCACAATGTGGG + Intronic
995349776 5:111161769-111161791 TCATGAAAACAGAAGTATGGGGG - Intergenic
995366873 5:111371913-111371935 TAGAGAAAACAGCAGAATTGAGG + Intronic
995453700 5:112330591-112330613 ATGAGAAAACTGAGGAATGGGGG + Intronic
995702735 5:114954545-114954567 AGAAGAAAACAGAAAAATGTGGG + Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996522147 5:124438971-124438993 TGAAGGAAACAGAACAATGGGGG + Intergenic
996872260 5:128204359-128204381 GGGAGTAAACAGAAGAAATGGGG - Intergenic
997183208 5:131854526-131854548 AGGAAAAAACAGAAGAATCCTGG + Intronic
997353778 5:133249215-133249237 AGCAGAAAATAGATGAATGGTGG - Intronic
997870669 5:137502684-137502706 AGGAGAACACAGAGGCATGGAGG - Intronic
998350079 5:141494781-141494803 TGGAGAAAACAGAGGGAAAGGGG - Intronic
998401673 5:141851781-141851803 TGGAGAAGCCAGAAGAAAGAGGG - Intergenic
998610976 5:143687897-143687919 TGGAATACACAGAAGAATTGGGG - Intergenic
998636242 5:143958150-143958172 TGGAAAAAAGAGGAGAATTGAGG + Intergenic
998708679 5:144795514-144795536 TAAAGAAAACAAAAGAATGAAGG - Intergenic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999007791 5:148001838-148001860 GGGTGAAAAGAGAAAAATGGGGG - Intergenic
999402655 5:151278299-151278321 TGAAGAGAAGAGAAGGATGGGGG - Intronic
999556730 5:152751813-152751835 TGGAGCAAGCAGAAGCAGGGTGG + Intergenic
999647274 5:153730483-153730505 TGGAGAAATAAGAATAATGATGG + Intronic
999947865 5:156617005-156617027 AGAAGAATACAGCAGAATGGAGG - Intronic
1000035424 5:157444072-157444094 TGCAGAAAACAGGACTATGGAGG + Intronic
1000466131 5:161579561-161579583 GGGAGATAACTGAATAATGGAGG - Intronic
1000526939 5:162369868-162369890 TGAAGAATACAGAAAAATGTGGG - Intergenic
1000554901 5:162714603-162714625 TGTAGAGAACAGAGGAGTGGGGG - Intergenic
1000760727 5:165221098-165221120 TGGAGATAACAGAGGAAAAGAGG - Intergenic
1002075693 5:176707132-176707154 TGGAGATAACTGAATCATGGAGG - Intergenic
1002193601 5:177491077-177491099 TGGAGAACACAGAGGACTGGCGG - Exonic
1002854867 6:1027656-1027678 GGAAAAAAACAGAAGAAGGGAGG + Intergenic
1003360640 6:5421860-5421882 AGAAGAAAACAGAAAAATGTGGG - Intronic
1003642225 6:7885670-7885692 TGGAGAAAACATAAAAATGGAGG - Intronic
1003665416 6:8107114-8107136 TGGATAAAACAAAAGTATGAGGG + Intergenic
1003684340 6:8286140-8286162 TTGAGTGAACAGAAGAATAGAGG - Intergenic
1004009124 6:11664709-11664731 GGTGGAAAACAGATGAATGGTGG + Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004049139 6:12057551-12057573 AACAGAAAACAGAACAATGGAGG - Intronic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004522324 6:16373597-16373619 GGGAGACAACTGAATAATGGGGG + Intronic
1004648216 6:17583363-17583385 TGAAGAAACCAGGAGAATTGTGG + Intergenic
1004700931 6:18078873-18078895 TGGAGAAAACAGAAACAGGAAGG + Intergenic
1005258588 6:24032111-24032133 TGGAGAAAATTGAATCATGGAGG - Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005616560 6:27578641-27578663 TGGGGAAAACAGAATAATTTTGG + Intergenic
1005956892 6:30670469-30670491 AGAAGAAAAAACAAGAATGGAGG + Intronic
1006054297 6:31370091-31370113 TGGAGATAACTGAAGAAATGTGG - Intergenic
1006586396 6:35117388-35117410 TGGAGAAGCCAGAAGGATGGAGG + Intergenic
1006729659 6:36227321-36227343 TGGAGTCAACATTAGAATGGTGG - Intronic
1006975149 6:38093498-38093520 TGAATAAAGAAGAAGAATGGGGG + Intronic
1007865996 6:44971551-44971573 TGATGAGAACAGAAGCATGGGGG + Intronic
1007925555 6:45646858-45646880 GGTAGAAAACAGAAGAAGAGAGG + Intronic
1008048218 6:46873277-46873299 TGGCAAACACAGAAGCATGGTGG - Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008293548 6:49749546-49749568 TCAAGAAAACAGTAGAATGCTGG - Intergenic
1008347980 6:50453100-50453122 AGGAGAAAAGAAAAGAAAGGAGG + Intergenic
1008383079 6:50855695-50855717 TAGAGAAAACTGAATCATGGGGG + Intergenic
1008410241 6:51169749-51169771 TGGAGACTACAGATGATTGGAGG + Intergenic
1008460574 6:51765124-51765146 TGGAGCACACTGATGAATGGAGG - Intronic
1009532782 6:64842510-64842532 AGGAGAAGACAGAAAAATGTGGG + Intronic
1009982559 6:70742949-70742971 TGGAGATAACTGAATCATGGGGG - Intronic
1010093697 6:72014279-72014301 TGGAGATAACTGAATCATGGGGG - Intronic
1010674197 6:78721718-78721740 TGCAGAAGAGAGAAGAATGAGGG - Intergenic
1011204273 6:84874674-84874696 TGTAGAGAATAGAAGAAAGGAGG + Intergenic
1011355295 6:86467126-86467148 TGGAGATAACTGAATCATGGGGG + Intergenic
1011419489 6:87156063-87156085 TGGAGAGAGTAGGAGAATGGAGG + Intronic
1011559467 6:88600056-88600078 TGGAAAAAACTTATGAATGGTGG - Intergenic
1011805951 6:91072544-91072566 TGGAGATAACTGAATCATGGGGG + Intergenic
1011900240 6:92285708-92285730 TGGAGGATACTGAAGACTGGAGG + Intergenic
1011968320 6:93188968-93188990 TGGAGAAAACATATGAAAGCTGG - Intergenic
1012170572 6:96013032-96013054 TGAAGAAAAGAGGAGAATGACGG - Intergenic
1012267273 6:97160956-97160978 TGAAGAAAACGAAAGTATGGTGG - Intronic
1012514055 6:100038435-100038457 TGGAGATAACTGAATCATGGGGG + Intergenic
1012518838 6:100095747-100095769 TGGAGATAACTGAATCATGGAGG - Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013066331 6:106687593-106687615 TAGAGAAAACAGAAATATTGGGG - Intergenic
1013190436 6:107800488-107800510 TGCAAAAACCAGAAGAATGTTGG + Intronic
1013265088 6:108488550-108488572 TGGGGAAAACACAAGAGTTGGGG + Intronic
1013438735 6:110139616-110139638 AGGAGAAAATATAAGACTGGAGG - Intronic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1013479777 6:110543737-110543759 TGGAGGAAGCAGGAGCATGGAGG + Intergenic
1013570027 6:111413287-111413309 GGGGGAAAAAAGTAGAATGGAGG + Intronic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1013725293 6:113088103-113088125 TGGACTAAACAGTGGAATGGAGG + Intergenic
1013743787 6:113320510-113320532 TGGAGAAAATTGAATCATGGGGG + Intergenic
1013871918 6:114774166-114774188 TTGAGAAAATGGAAGAATTGTGG - Intergenic
1014435329 6:121414751-121414773 TGAAGATAACAGAAGAATAAAGG + Intergenic
1014703798 6:124722005-124722027 TGGAGGAGAAAGTAGAATGGTGG - Intronic
1015209728 6:130683408-130683430 GGGAGAAAACAGAATCCTGGGGG + Intergenic
1015355952 6:132277280-132277302 TGGAGATAACTGAATCATGGGGG - Intergenic
1015713558 6:136167186-136167208 TGGAGAGAAGAGCAGAATAGTGG - Intronic
1016139597 6:140592941-140592963 TGGAGAAAACTGAATCATGGCGG + Intergenic
1016198380 6:141375063-141375085 TGGAGATAAGAGTAGAATGATGG - Intergenic
1016296106 6:142574955-142574977 TGGAGATAATTGAATAATGGGGG + Intergenic
1016594975 6:145788824-145788846 TGGATAAAACAAAAACATGGAGG + Intergenic
1017186021 6:151601268-151601290 TGGAGATAACTGAATCATGGGGG - Intronic
1017333667 6:153229309-153229331 TGGGAAAAACAGAAGAGTGAAGG + Intergenic
1017454251 6:154586291-154586313 GGGAGAAAAAAGAAAAATGAAGG + Intergenic
1017678551 6:156840325-156840347 TGGAGAAAACAGAACAGGGCAGG - Intronic
1017797465 6:157858881-157858903 TGGAGATAACTGAATCATGGGGG - Intronic
1019039226 6:169089721-169089743 TGGAGATAACTGAAGCATGGGGG + Intergenic
1019088603 6:169504350-169504372 TGGAGATAACTGAATCATGGGGG + Intronic
1019226493 6:170514838-170514860 TGGACTCAACAGCAGAATGGAGG + Intergenic
1019336462 7:485190-485212 GGGAGAGAACAAAAGAAAGGAGG + Intergenic
1019883403 7:3883210-3883232 TGCAGAAAACAGAGGAAAGCAGG - Intronic
1019897412 7:3993291-3993313 TGGCTGAAACAGAAGAATGGTGG + Intronic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020848423 7:13317279-13317301 TGAAGTAAACAGAGGAAGGGAGG + Intergenic
1021159541 7:17255140-17255162 TGAAGGAAAAAGCAGAATGGAGG + Intergenic
1021246084 7:18263148-18263170 TGTAGAAAGTAAAAGAATGGAGG + Intronic
1021518232 7:21510075-21510097 GGGAGATAACTGAATAATGGGGG - Intronic
1021549592 7:21855780-21855802 TGGACAAAACATAAGGGTGGAGG + Intronic
1021566988 7:22025809-22025831 TGTAGAAAACTAAACAATGGTGG + Intergenic
1022484222 7:30765580-30765602 TGGATAAGACAGAACTATGGGGG + Intronic
1022726809 7:32988594-32988616 TGGAGAAAAGCGAAGGATTGTGG + Exonic
1023676050 7:42631520-42631542 TGGAGAAAATTGAATCATGGGGG - Intergenic
1023733496 7:43214860-43214882 TGGAACACACAGAAGACTGGAGG - Intronic
1024528772 7:50373136-50373158 GGAAGGAAACAGAAGCATGGGGG - Intronic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025641488 7:63376321-63376343 TGGAGAAAACAGAAACATGCAGG + Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026159694 7:67857790-67857812 TGGAGAAAGCAGACTGATGGTGG + Intergenic
1026308123 7:69160193-69160215 TAGAGAAAATAGAAGAATCAAGG - Intergenic
1027157728 7:75780381-75780403 GGGAGAAGAGAGAGGAATGGAGG - Intronic
1027158083 7:75782528-75782550 GGGAGAAAAAGGAAGAATGGAGG - Intronic
1027332857 7:77117653-77117675 ATAAGAAAACAGAAGAATGATGG + Intergenic
1027558099 7:79691844-79691866 TGGAGATAACTGAATCATGGAGG + Intergenic
1027656825 7:80940734-80940756 TGGAAAAAGCAGAAGAAAGAAGG + Intergenic
1027745189 7:82064232-82064254 TGTAGATAACAGTAGTATGGTGG - Intronic
1028317070 7:89416418-89416440 TAGAGAAAGCAGAAAAGTGGTGG - Intergenic
1028318251 7:89431220-89431242 TGGAGACAACTGAATCATGGGGG - Intergenic
1028401383 7:90429320-90429342 TGGAGATAACTGAATCATGGGGG + Intronic
1028708149 7:93874680-93874702 TGGAGATAACTGAATCATGGGGG + Intronic
1029055387 7:97734964-97734986 TGAAGACAATATAAGAATGGGGG + Intronic
1029193899 7:98791030-98791052 TGGAGAAAACACCAGAATTCTGG + Intergenic
1029430573 7:100526580-100526602 AGGAGAGAAGAGAAAAATGGAGG - Intergenic
1029782927 7:102753644-102753666 ATAAGAAAACAGAAGAATGATGG - Intronic
1030296505 7:107934111-107934133 TGAAGAAAAAAGAAAAATGAAGG - Intronic
1030346112 7:108434362-108434384 TGGAGAAAACAAAAAACTAGTGG + Intronic
1030411723 7:109189387-109189409 TGGAGATAACTGAATCATGGGGG - Intergenic
1030860678 7:114622266-114622288 TGGTGAATAGAGAGGAATGGTGG - Intronic
1031419097 7:121528243-121528265 TGGGGAGAAGAGAAGAAAGGAGG + Intergenic
1031475273 7:122213536-122213558 TGGTGAAAATAGAGGAATTGAGG + Intergenic
1031777194 7:125918863-125918885 GGGAGAAGAAGGAAGAATGGAGG - Intergenic
1031869482 7:127076556-127076578 GGAATAAAAGAGAAGAATGGAGG - Intronic
1032062108 7:128733610-128733632 TGGAGAAAACTGGAGCAAGGAGG - Intergenic
1032188770 7:129750548-129750570 TGTAGAAAACAGCGGAATTGGGG + Intronic
1032272158 7:130419267-130419289 TGGGGAAAAAAGGAGAATGGAGG + Intronic
1032688504 7:134259291-134259313 TGGGGAAAACAAAGGACTGGAGG + Intronic
1032888906 7:136172169-136172191 TGTAGAAAACAGATAAATGTGGG + Intergenic
1033086461 7:138346425-138346447 TGGAGGAAACAGAAGCTGGGAGG + Intergenic
1033120879 7:138665257-138665279 TTGAGAAAACTAAAGAATTGTGG - Intronic
1033198836 7:139350972-139350994 AGAAAAAAACAGAAGAATGTGGG - Intronic
1033429971 7:141280377-141280399 GGGAGATAACAGAATCATGGGGG + Intronic
1033845787 7:145430111-145430133 TGGAGATAACTGAATCATGGGGG - Intergenic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034718464 7:153265184-153265206 TGAAGAAAACAGAAAAATGTGGG - Intergenic
1035380797 7:158439474-158439496 TGGGGAAGAGAGAAGAAAGGAGG + Intronic
1035452263 7:158985122-158985144 GGGAGATAACAGAATCATGGGGG - Intergenic
1036528767 8:9561397-9561419 TGGAAAAAACATCAGAATGGTGG - Intronic
1036685538 8:10907183-10907205 TGGTGTAAACATAAGAAAGGAGG + Intronic
1036787244 8:11696322-11696344 TGAAGAAGACAGAACAATAGGGG - Intronic
1036978021 8:13436639-13436661 TGCAGAAAACAGACGAACGGAGG + Intronic
1037037183 8:14181589-14181611 TGGAGATAACTGAAGCATGGGGG + Intronic
1037233029 8:16682921-16682943 TGAAGAAAACTGAAGAAATGAGG - Intergenic
1037319528 8:17630160-17630182 TGGGGAAAACAGAAGAAAGACGG - Intronic
1038318856 8:26510779-26510801 TTGAGAAAAAAGAAAAAAGGAGG + Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038719037 8:30016815-30016837 TGGAGATAACTGAATCATGGGGG - Intergenic
1038842729 8:31200975-31200997 TGGAAAAAGCAAAACAATGGAGG - Intergenic
1039042960 8:33425461-33425483 TGGAATAAACAGAAAAAAGGAGG + Intronic
1039235407 8:35497395-35497417 TTGAGAAAACAGCAGTAGGGAGG - Intronic
1039298325 8:36182035-36182057 AGGAGAAGACAGAAAAATGTGGG - Intergenic
1039542669 8:38384154-38384176 AGGAAGAAAAAGAAGAATGGAGG - Intergenic
1040741243 8:50578996-50579018 AGAAGAAAACAGGAGAATGTAGG + Intronic
1041150804 8:54931713-54931735 GGGAGAAATCAGAAGAAAGGAGG - Intergenic
1041190983 8:55354044-55354066 TTGATAAAACTGAAGAATTGTGG + Intronic
1041552491 8:59118339-59118361 TTGAGAAAACAAAAGAGTTGTGG + Intronic
1041562249 8:59232188-59232210 TTCAGAAAACAGAAAAATTGTGG - Intergenic
1041595512 8:59646301-59646323 TGGAGATAACTGAATCATGGAGG - Intergenic
1041775893 8:61522548-61522570 TGGAGATAACTGAATCATGGGGG + Intronic
1041917683 8:63152778-63152800 TGGAGAAGAAGGAGGAATGGAGG + Intergenic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042192455 8:66201044-66201066 TCAAGAAAACAGAAGACTTGGGG + Intergenic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043378293 8:79674429-79674451 TGGAGATAACTGAACCATGGGGG + Intergenic
1043419371 8:80083435-80083457 TGGAGTAAACTGAATCATGGGGG + Intronic
1043638273 8:82414172-82414194 TGGAGATAACTGAATCATGGGGG - Intergenic
1043775411 8:84261344-84261366 TGGAGATAATAGAATCATGGGGG + Intronic
1044858880 8:96502288-96502310 TGGAGATAACTGAAACATGGGGG - Intronic
1045457391 8:102394583-102394605 TGGAGAAACCAGTAGAATCACGG - Intronic
1045659246 8:104419499-104419521 TGGGGAAAACAGCTGTATGGTGG + Intronic
1045840039 8:106569245-106569267 TTGAGAAGAAAGAAGAAGGGGGG - Intronic
1046074751 8:109302079-109302101 GGGAGAAAAAGGAGGAATGGAGG - Intronic
1046092863 8:109524165-109524187 TGGGACAAACAGAACAATGGAGG - Intronic
1046151157 8:110228163-110228185 TTGAGAAAACAGAAATGTGGGGG - Intergenic
1046300258 8:112277501-112277523 AGGAGAAGACAGAAAAATGTGGG - Intronic
1046424491 8:114029095-114029117 TTTAGAAAACAGAAGATTCGAGG - Intergenic
1046441630 8:114262741-114262763 TGAAGATAACTGAATAATGGTGG + Intergenic
1046598355 8:116288096-116288118 TGAAGAAAGCATAAGCATGGTGG + Intergenic
1047315665 8:123730864-123730886 TGGGGAAATGAGCAGAATGGGGG + Intronic
1047632303 8:126721632-126721654 TGGGGAAAAAAGATGGATGGTGG - Intergenic
1047691166 8:127356135-127356157 TAGAGAAAACAGAAGAGGAGTGG + Intergenic
1047814333 8:128446118-128446140 TGGAGAAAGTAGAAGAAAGAAGG - Intergenic
1050163726 9:2743413-2743435 TTGGGATTACAGAAGAATGGGGG + Intronic
1050338789 9:4615181-4615203 TGGAGTATAAAGAAGAAGGGTGG - Intronic
1050889822 9:10810182-10810204 TGGAGATAACTGAATCATGGGGG + Intergenic
1050897631 9:10902905-10902927 TGGAGATAACTGAATAATGGGGG - Intergenic
1051059968 9:13034461-13034483 GGGAAACAGCAGAAGAATGGGGG - Intergenic
1051322688 9:15925681-15925703 TAAAGAAAACAGTGGAATGGGGG + Intronic
1051421999 9:16897957-16897979 TGGAGATAACTGAATCATGGGGG - Intergenic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051933494 9:22414881-22414903 AAGAGAAAACAAAAGAATAGAGG - Intergenic
1052019273 9:23507540-23507562 AGGAGAAGACAGAAAAATGTGGG + Intergenic
1052101677 9:24454384-24454406 TGGAGATAACGGAACCATGGAGG + Intergenic
1052626565 9:30982925-30982947 TGGAGATAATTGAAGCATGGGGG - Intergenic
1054932771 9:70653311-70653333 TGGAGAGAATAGAGGAATGTGGG + Intronic
1055543522 9:77341544-77341566 GGAAAAAAACGGAAGAATGGAGG - Intronic
1055802663 9:80057296-80057318 AGAAGAAAAGAGTAGAATGGTGG + Intergenic
1055946875 9:81699743-81699765 TGGAGGCAACAGTAGAATGGTGG + Intergenic
1056120116 9:83479381-83479403 AGGAGAAAAAGGAAGAAAGGAGG + Intronic
1056414564 9:86364011-86364033 TGGGGAAAAAAAAAGGATGGGGG - Intergenic
1056624347 9:88241854-88241876 AGGAGATAAGAGAAGAAAGGAGG + Intergenic
1056935271 9:90911407-90911429 TGGATAAAAAAGAAGAAAAGGGG - Intergenic
1057006010 9:91560552-91560574 TTCAGAAAACAGAAGAATGCTGG - Intergenic
1057300854 9:93880877-93880899 TGGAGATAATAGAATTATGGGGG - Intergenic
1057925127 9:99139817-99139839 AGGAGAAAAAAGATGAAGGGGGG - Intronic
1057956379 9:99411586-99411608 TGAAGAAAACAGTAGAGTGGGGG + Intergenic
1058047297 9:100370371-100370393 TGGAGATAACTGAATCATGGGGG - Intergenic
1058148055 9:101433249-101433271 GGCAGTAAACAGAAAAATGGAGG - Intronic
1058189153 9:101891834-101891856 TGTAGAAACCACAAAAATGGAGG - Intergenic
1058491886 9:105510526-105510548 TGGAGAGAAAGGAAGAAAGGTGG + Intronic
1058552786 9:106133470-106133492 GGGAGAAAAGAGAGGAAAGGAGG - Intergenic
1058654265 9:107205669-107205691 AGGAGCAGACAGTAGAATGGTGG - Intergenic
1058884200 9:109310996-109311018 TAGACAAAAAAGTAGAATGGTGG + Intronic
1059082321 9:111263438-111263460 TGGGGCAAACAGTAGATTGGGGG - Intergenic
1059246060 9:112850679-112850701 TGGAGGAAGCAGGAGAAAGGAGG - Intronic
1059563683 9:115360752-115360774 AGAAGAAAACAGAAGCCTGGTGG + Intronic
1060017045 9:120095863-120095885 TGAAGAGAACAAAAGAGTGGAGG - Intergenic
1060264943 9:122106308-122106330 TGGAGATAACTGAATCATGGGGG - Intergenic
1060954862 9:127631425-127631447 TGAAGAAAACAAAACACTGGTGG + Intronic
1060997193 9:127881403-127881425 TAGAAAAAAAAGTAGAATGGTGG + Intergenic
1061321073 9:129829958-129829980 AGAAGAAAACAGAAGAATAAAGG + Intronic
1061350136 9:130057744-130057766 TGGGAAAGCCAGAAGAATGGTGG - Intronic
1061739398 9:132689485-132689507 TGCATAAAAAACAAGAATGGAGG - Exonic
1062641181 9:137519421-137519443 TGGGAACAACTGAAGAATGGAGG + Intronic
1203450126 Un_GL000219v1:104516-104538 TGATAAAAAAAGAAGAATGGAGG + Intergenic
1185700026 X:2223791-2223813 TGGAGAAGGAAGAAGAATGCCGG - Intronic
1185797871 X:2982170-2982192 TGGAGATAACTGAATCATGGAGG + Intergenic
1185876028 X:3703096-3703118 TGGAGAGAAGAGAAGAGAGGAGG - Intronic
1185949923 X:4421676-4421698 TGGAAAAAAAAAAAGAAAGGAGG + Intergenic
1187365977 X:18666242-18666264 TGGAGAAAACACAAGGAAGTAGG + Intronic
1187456859 X:19448919-19448941 GGGAAAAAAAAGTAGAATGGTGG - Intronic
1187592647 X:20735267-20735289 GGGAGAAACTAGAAGAAAGGAGG + Intergenic
1187632419 X:21188969-21188991 TGGATCAAATATAAGAATGGAGG + Intergenic
1187855462 X:23632567-23632589 TGGAGACTACAGAAGATAGGAGG - Intergenic
1187896752 X:23989155-23989177 TGTAGAAAACAAAAGAAAGTAGG - Intronic
1188071713 X:25726228-25726250 TGGAGACAACTGAATCATGGGGG + Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188394306 X:29661725-29661747 TTGAGCAAACACATGAATGGTGG - Intronic
1188405543 X:29804455-29804477 TGGAGATAACTGAATCATGGGGG + Intronic
1188552505 X:31378781-31378803 GGGAGAAAAAGGAGGAATGGAGG - Intronic
1188764394 X:34074356-34074378 TGTAGAAAACAGATGAATCTTGG + Intergenic
1188894414 X:35649356-35649378 AGGAGGAAATAGAAAAATGGAGG + Intergenic
1189001823 X:36956239-36956261 TTGAGGTAACAGAAGAATAGGGG - Intergenic
1189256367 X:39642703-39642725 GGGAGAAAATAGAAGAGGGGAGG + Intergenic
1189488709 X:41452891-41452913 TGGAGGAAACAGAAGTGCGGAGG - Intronic
1190495952 X:51028737-51028759 TGGGGAAAACAGTACAATTGGGG + Intergenic
1190510038 X:51165353-51165375 TGGGGAAAACAGTACAATTGGGG - Intergenic
1190651828 X:52575473-52575495 TTCAAAAAACAGAGGAATGGAGG - Intergenic
1190914421 X:54799989-54800011 TAGAGAAAACAAAACAATGAAGG + Intergenic
1191644344 X:63464130-63464152 AAGAGAAAACAGAAAAATGCAGG - Intergenic
1191832596 X:65431021-65431043 TTGATAAAACAGAGGAATGGGGG - Intronic
1192131448 X:68555372-68555394 AGGACAAAAAAGAAAAATGGAGG + Intergenic
1192170090 X:68848994-68849016 TGAATAAAACAGAAGCACGGAGG - Intergenic
1193188384 X:78539855-78539877 AGGAGAAGACAGAATAATGAAGG - Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1193396154 X:80986147-80986169 TGGAGAAAAGAGAAAAAAGCAGG - Intergenic
1193441581 X:81546014-81546036 TAGAGAAAAGTGATGAATGGAGG - Intergenic
1193699021 X:84741116-84741138 TGCAGGGAACAGAAGAGTGGAGG - Intergenic
1193729540 X:85086457-85086479 TTGAGAAACTGGAAGAATGGAGG - Intronic
1194374897 X:93120272-93120294 TGGAAAAAACAAAAGTGTGGTGG - Intergenic
1194825415 X:98556524-98556546 TGGAGATAACTGAATCATGGGGG - Intergenic
1194843515 X:98775334-98775356 AGAAGAAGACAGAAAAATGGGGG + Intergenic
1195815231 X:108877939-108877961 TGAAGAAAGCAGAAGAAAGGGGG + Intergenic
1196570169 X:117256816-117256838 TTGAGTAAAAAGATGAATGGTGG + Intergenic
1196674988 X:118410264-118410286 AGGAGAAAGGAGAAGAAAGGTGG + Intronic
1197498968 X:127221129-127221151 TGGAGATAATTGAATAATGGGGG + Intergenic
1198207755 X:134484022-134484044 TGGGGCAAACAGGAGTATGGAGG + Intronic
1198411937 X:136379482-136379504 AGGAGAAGACAGGAGAAAGGAGG - Intronic
1198594091 X:138217403-138217425 TGGAGAAGACAGAAGCATCTAGG - Intergenic
1198598312 X:138260053-138260075 GGGAGAAGAAGGAAGAATGGAGG - Intergenic
1198660943 X:138966844-138966866 TGGAGATAACTGAATCATGGGGG + Intronic
1198995443 X:142568604-142568626 TGGAGTGAGCAGAAGCATGGTGG + Intergenic
1199193426 X:144998149-144998171 TGGAGATAACTGAATCATGGGGG + Intergenic
1199249252 X:145640089-145640111 TGGAGATAACTGAATCATGGGGG + Intergenic
1199301597 X:146220342-146220364 TGGAGATAACTGAATCATGGGGG - Intergenic
1199571495 X:149271399-149271421 GGGAGAAAATTGAATAATGGGGG - Intergenic
1199737271 X:150695808-150695830 TGGAGTTCACAGAAGAATGATGG + Intronic
1199900783 X:152169931-152169953 AGGAGAAAAAATAAGAATGATGG - Intronic
1200032775 X:153309836-153309858 AGGAGAAAAAAGAAGAAAAGTGG + Intergenic
1200789551 Y:7287328-7287350 TGGAGAGAAGAGAAGAGAGGAGG + Intergenic
1201267566 Y:12223041-12223063 TGGAAAAAACAAAACTATGGAGG + Intergenic
1201307648 Y:12564386-12564408 GGGAGAAAAGGGAGGAATGGAGG + Intergenic
1201697034 Y:16837416-16837438 TGGAGAAAAAAGGTGAATGGGGG - Intergenic
1202606535 Y:26644080-26644102 AGGGGAAAAGAGAGGAATGGAGG + Intergenic