ID: 917661572

View in Genome Browser
Species Human (GRCh38)
Location 1:177181884-177181906
Sequence CGCCTGCGCCTCTGCGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917661572_917661585 13 Left 917661572 1:177181884-177181906 CCCCGGCCGCAGAGGCGCAGGCG 0: 1
1: 0
2: 3
3: 18
4: 197
Right 917661585 1:177181920-177181942 GGAGGTTGCCGAGGAGTGGCCGG 0: 1
1: 0
2: 1
3: 16
4: 285
917661572_917661580 4 Left 917661572 1:177181884-177181906 CCCCGGCCGCAGAGGCGCAGGCG 0: 1
1: 0
2: 3
3: 18
4: 197
Right 917661580 1:177181911-177181933 TCTTGCCCCGGAGGTTGCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 60
917661572_917661579 -5 Left 917661572 1:177181884-177181906 CCCCGGCCGCAGAGGCGCAGGCG 0: 1
1: 0
2: 3
3: 18
4: 197
Right 917661579 1:177181902-177181924 AGGCGGGATTCTTGCCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 63
917661572_917661578 -8 Left 917661572 1:177181884-177181906 CCCCGGCCGCAGAGGCGCAGGCG 0: 1
1: 0
2: 3
3: 18
4: 197
Right 917661578 1:177181899-177181921 CGCAGGCGGGATTCTTGCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 55
917661572_917661582 9 Left 917661572 1:177181884-177181906 CCCCGGCCGCAGAGGCGCAGGCG 0: 1
1: 0
2: 3
3: 18
4: 197
Right 917661582 1:177181916-177181938 CCCCGGAGGTTGCCGAGGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917661572 Original CRISPR CGCCTGCGCCTCTGCGGCCG GGG (reversed) Intronic