ID: 917663271

View in Genome Browser
Species Human (GRCh38)
Location 1:177198511-177198533
Sequence TGGGTACTAATGAATCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917663265_917663271 15 Left 917663265 1:177198473-177198495 CCTTGGCTTGAGATGTAAAATTG 0: 1
1: 0
2: 1
3: 12
4: 171
Right 917663271 1:177198511-177198533 TGGGTACTAATGAATCATGTGGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917663271 Original CRISPR TGGGTACTAATGAATCATGT GGG Intronic
901927630 1:12576686-12576708 TGGCTACTAATGTTTCCTGTTGG - Intronic
904182492 1:28676090-28676112 TGGGTACTAATGTATGGTGTGGG + Intronic
904925463 1:34044116-34044138 TGAGTCCTAATAAATCATGCGGG + Intronic
906767614 1:48448587-48448609 TGGGCAATTATGAACCATGTTGG - Intronic
907903649 1:58764484-58764506 TTGCTACAAATGATTCATGTGGG + Intergenic
917616092 1:176745949-176745971 TGGGCACTAATGAAACTTGATGG + Intronic
917663271 1:177198511-177198533 TGGGTACTAATGAATCATGTGGG + Intronic
917718101 1:177758517-177758539 AGGGTTCTATTGACTCATGTAGG - Intergenic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
924281657 1:242443997-242444019 TGGATACTGATGATTCATGATGG - Intronic
1064082907 10:12322951-12322973 CGGGCACTGATTAATCATGTAGG + Intergenic
1064843078 10:19617983-19618005 TGGGGACTACTGAAGCATGGAGG - Intronic
1066300763 10:34093614-34093636 TGGTTACTATTTAATGATGTTGG - Intergenic
1066633543 10:37479711-37479733 TGGGCACTAATTAATCTTGTGGG + Intergenic
1067574259 10:47398364-47398386 TGGGTAGGATTGAATCCTGTAGG - Intergenic
1068257037 10:54525369-54525391 TTGGTAGTAATAAAACATGTGGG - Intronic
1070548849 10:77474830-77474852 TGGGAACTATTCAATTATGTTGG + Intronic
1072288784 10:93942917-93942939 TGGTTACTAGAGAATTATGTTGG - Intronic
1073850468 10:107611498-107611520 TGGGTATGAATGAAAAATGTGGG - Intergenic
1077969674 11:7175706-7175728 TGGGTACTAACCAATCAAGATGG - Intergenic
1079505670 11:21149551-21149573 TGGAGATAAATGAATCATGTGGG - Intronic
1082973991 11:59054253-59054275 TGCATACTAAAGATTCATGTGGG + Intergenic
1082978400 11:59098041-59098063 TGCATACTAAAGATTCATGTGGG + Intergenic
1086793317 11:91068382-91068404 TGGGAAATTATGATTCATGTTGG + Intergenic
1093011606 12:14112972-14112994 AGGTTACTAATAAATCAAGTTGG + Intergenic
1095298646 12:40556704-40556726 TGGGTACTGATGAGTTATTTAGG + Intronic
1105842639 13:24268186-24268208 TGATTACTGATGAATCCTGTAGG + Intronic
1108159908 13:47628289-47628311 TGGGTACAACTGAATTAGGTAGG + Intergenic
1108868803 13:54956817-54956839 TGAGAACTAATGAATAATCTTGG - Intergenic
1110208496 13:72946325-72946347 TGGGAAGTAATTAATCATGCGGG - Intronic
1110995920 13:82109391-82109413 TGGGGACAAATGCAACATGTAGG - Intergenic
1115413546 14:33103693-33103715 TGGGTAATAATGAAGGGTGTTGG + Intronic
1119469104 14:74882379-74882401 TGGGTATTAATGAGTCCCGTTGG + Intronic
1123678722 15:22739982-22740004 GGGGTATTTATGAATCAGGTGGG + Intergenic
1124330928 15:28814265-28814287 GGGGTATTTATGAATCAGGTGGG + Intergenic
1129288556 15:74545445-74545467 TGAGTCCTAATGAATTATCTTGG + Intronic
1130846964 15:87756610-87756632 TGGGTACTGAGGAAGCATGCAGG - Intergenic
1137648603 16:50098186-50098208 TGGGTACAAATGTATCTTTTTGG - Intronic
1139466505 16:67156777-67156799 TGGGGACAACTGAACCATGTGGG - Intronic
1139635587 16:68256434-68256456 TGGATACTAATCCACCATGTTGG - Intronic
1140938007 16:79693010-79693032 TCTGTAATAATGAATCATTTAGG - Intergenic
1141822083 16:86453362-86453384 TGGGGACAATTGAATCATGGGGG + Intergenic
1143271823 17:5681399-5681421 TGGGTAGAAATGCATCATCTTGG - Intergenic
1150092616 17:62342011-62342033 TGGGAGGTAATGAATCATGCGGG - Intergenic
1153917343 18:9757843-9757865 TGGATGCTAATCCATCATGTCGG + Intronic
1158007477 18:52689432-52689454 TGGGAAGTAATGAATGAGGTTGG + Intronic
1158330711 18:56359007-56359029 TGGGAAGTAATGGATCATGGGGG + Intergenic
1159234786 18:65657510-65657532 TGGTTACTAAAGAGTCATCTAGG + Intergenic
1167226941 19:48251161-48251183 TGGATACTAAAGAATTTTGTAGG + Intronic
928919158 2:36507954-36507976 TGGCTACAAATGAATTATGTTGG - Intronic
942948704 2:181698346-181698368 AGGGTACTAATGAAGCTTGGTGG - Intergenic
946683477 2:222242523-222242545 TGAGTTCTCATGAATCAGGTAGG - Intronic
946684184 2:222250789-222250811 TAGTTTCTAATGAATCATTTGGG - Intronic
946960296 2:224978121-224978143 TGGGTACTAATGGAGCAAGAAGG + Intronic
1168758737 20:334082-334104 TGGTTACAAATGGATCATGAAGG - Intergenic
1169730195 20:8777994-8778016 TGGGAGGTAATGAATCATGGGGG - Intronic
1171333330 20:24360591-24360613 TGGGTATGAATGAATCAGGTAGG - Intergenic
1174728077 20:52885956-52885978 AGGGTACTACTGCATCAAGTTGG + Intergenic
1179962454 21:44776634-44776656 TGGGAAGTACTGAATCATGGAGG + Intronic
951164820 3:19472402-19472424 TGGGAGATAATGAATCATGTGGG + Intronic
952489339 3:33851399-33851421 GGGGTATTTATGAATCAGGTGGG + Intronic
953657734 3:44866774-44866796 TGGGTACTAAGGAGTCATTGCGG - Intronic
955554998 3:60127242-60127264 TGGGTACTCATTAATAAAGTTGG - Intronic
957703870 3:83754911-83754933 TGGGAGATAATGAATCATGGAGG + Intergenic
958903709 3:99918676-99918698 TGGGTACTAAAAAACCATTTAGG - Intronic
963432884 3:145231941-145231963 TGGATATTACTGAATCCTGTAGG + Intergenic
963975056 3:151471066-151471088 TGGGGATTATTGAATCATGGGGG + Intergenic
964923554 3:161927290-161927312 TGGGAGGTAATGAATCATGGGGG + Intergenic
965509078 3:169548425-169548447 TGCGTACCTATGAATCATATAGG - Intronic
968230290 3:197001801-197001823 TCAGTGCTAATGAAACATGTTGG - Exonic
973149142 4:46865873-46865895 TGTGTACTAAGGGATCATGGTGG - Intronic
974645501 4:64686248-64686270 TGAGAACTAATTAATCATCTTGG - Intergenic
976135131 4:81927458-81927480 TGGGTACTTATGGATCATGAAGG + Intronic
982389783 4:154851933-154851955 TGGGACATAATGAATCATGGTGG - Intergenic
983136620 4:164092011-164092033 TGGGTACAAAGTCATCATGTTGG + Intronic
986911897 5:12567629-12567651 TGGGCTCAAATGGATCATGTGGG - Intergenic
987426964 5:17784641-17784663 TGGGTTCTAATGATTCACTTTGG - Intergenic
991172119 5:63640473-63640495 TGGCTACTAATATTTCATGTTGG - Intergenic
992982079 5:82186269-82186291 TGGGTATTAATAAGTCATTTAGG + Intronic
995089886 5:108161628-108161650 TGGGCAATAATGAATCAACTCGG + Intronic
995455068 5:112342534-112342556 TGGTAACTAATGCATCACGTGGG - Intronic
997057175 5:130458774-130458796 TGGGAAGTAATTAATCATGGGGG + Intergenic
997901684 5:137772337-137772359 TGGGTACTGGGGCATCATGTTGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1001322635 5:170695434-170695456 TGGGGAGTAATGAATCAAATGGG - Intronic
1006203538 6:32318966-32318988 TGGGTTCTAATGCATCATTAAGG + Intronic
1007285366 6:40743742-40743764 TGGGTACCAGTGCATCACGTGGG + Intergenic
1007864721 6:44955818-44955840 TTGCTACTAAAGATTCATGTAGG + Intronic
1009699621 6:67159788-67159810 TGGGAGGTAATGAATCATGGGGG + Intergenic
1013600697 6:111701795-111701817 TGGATTCTAATGAAACATTTGGG - Intronic
1014601341 6:123417001-123417023 TGGGTACTAAAGAATAATGGTGG - Intronic
1016764508 6:147777010-147777032 TGGAAACTAATCAATCAAGTTGG - Intergenic
1017855408 6:158346669-158346691 TGGGTTCTAAAGATTCATTTAGG + Intronic
1021177632 7:17468411-17468433 TGGGTACTATTTAATCAGGGAGG - Intergenic
1024252569 7:47517559-47517581 TGGGTATTAATGAATACTGGTGG - Intronic
1028053539 7:86215038-86215060 TGGGCACTAACGAATCTTTTTGG - Intergenic
1031552451 7:123132039-123132061 TGGGGACTATTCAATCATGCAGG - Intronic
1038139942 8:24833587-24833609 TGAGAAGTAATGAATCATGGAGG - Intergenic
1038679257 8:29651906-29651928 TCGGTACTTATGACCCATGTGGG - Intergenic
1038746458 8:30259174-30259196 TGGGAGGTAATGAATCATGGGGG + Intergenic
1040967955 8:53102741-53102763 TGGGCACTAATGAACCTTGATGG - Intergenic
1042526989 8:69773753-69773775 TGTCTACTGATGAATCATGGAGG - Intronic
1044483606 8:92723292-92723314 TGGATACAAATGAAACAAGTAGG + Intergenic
1050448285 9:5751132-5751154 TGAGTACTTATGAAACGTGTGGG - Intronic
1051865392 9:21674770-21674792 TGGGTATTAATGAATTATGATGG + Intergenic
1055245454 9:74236485-74236507 ATGGTACAAATTAATCATGTTGG - Intergenic
1056225298 9:84489334-84489356 TGAGCAATAATGGATCATGTGGG + Intergenic
1059907815 9:119007765-119007787 TGGTTATTTATGAATGATGTAGG - Intergenic
1185950760 X:4430674-4430696 TAGGTACTAATGACTCATGAAGG - Intergenic
1187798090 X:23026754-23026776 TGCATACTAATGAATCAAGGTGG + Intergenic
1191866983 X:65711876-65711898 TGGGTACTCATGCAAGATGTTGG - Intronic
1194829808 X:98608511-98608533 TTGTTACTAATTAATCATATGGG - Intergenic
1197652192 X:129077367-129077389 TGGATAATAATGACTCAAGTTGG - Intergenic
1197838783 X:130723170-130723192 TGGATACCAATGAATCAGGAGGG + Intronic