ID: 917663404

View in Genome Browser
Species Human (GRCh38)
Location 1:177199980-177200002
Sequence GAATACATTCTAGGATACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917663404_917663414 27 Left 917663404 1:177199980-177200002 CCATGGTATCCTAGAATGTATTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 917663414 1:177200030-177200052 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
917663404_917663413 26 Left 917663404 1:177199980-177200002 CCATGGTATCCTAGAATGTATTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 917663413 1:177200029-177200051 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
917663404_917663409 -1 Left 917663404 1:177199980-177200002 CCATGGTATCCTAGAATGTATTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 917663409 1:177200002-177200024 CTCAGGCCAGGCGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 38
4: 300
917663404_917663410 0 Left 917663404 1:177199980-177200002 CCATGGTATCCTAGAATGTATTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 917663410 1:177200003-177200025 TCAGGCCAGGCGCCAGGTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 196
917663404_917663408 -6 Left 917663404 1:177199980-177200002 CCATGGTATCCTAGAATGTATTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 917663408 1:177199997-177200019 GTATTCTCAGGCCAGGCGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917663404 Original CRISPR GAATACATTCTAGGATACCA TGG (reversed) Intronic
903785294 1:25857164-25857186 GAATACATTCTTGAATGACATGG - Intronic
905845383 1:41226826-41226848 GAATAGATTCTGGGAGATCAAGG + Intronic
908495161 1:64687668-64687690 GCAGACATTCTAGGATACACTGG - Intronic
910277091 1:85461389-85461411 GAATACTTTCTTGAATTCCAAGG + Intronic
910325011 1:85996766-85996788 ATATACATTCTATGAAACCAAGG - Intronic
911702893 1:100975458-100975480 AAATACATTTTTGGATACAAAGG - Exonic
914893126 1:151645676-151645698 GAAAAGATTCTAGGTAACCATGG - Intronic
917663404 1:177199980-177200002 GAATACATTCTAGGATACCATGG - Intronic
920744522 1:208613940-208613962 GAAGACAGGCTAGGATGCCATGG - Intergenic
922708614 1:227808158-227808180 GAAAATATTCTTGGATAGCAGGG - Intergenic
923873942 1:238027404-238027426 GAATACATTCTGGGGAACTAAGG + Intergenic
924538887 1:244962541-244962563 GATTACATTCAAGGGTAACAAGG + Intergenic
1065614726 10:27508167-27508189 GAATACTTTTTGGGCTACCAGGG + Intronic
1065808109 10:29413592-29413614 GAATACATTTTGGGCTACCAGGG + Intergenic
1071088349 10:81890598-81890620 GAATACACTGTGGAATACCAGGG - Intronic
1071310321 10:84337243-84337265 GAAAACATTACAGGATCCCAAGG - Intronic
1074424164 10:113336420-113336442 GCATGGCTTCTAGGATACCAAGG - Intergenic
1077737725 11:4808799-4808821 CAATTCAGTCTTGGATACCAGGG - Intronic
1077889626 11:6409842-6409864 GAATAGATACTAGGACTCCAGGG - Intronic
1077947730 11:6920373-6920395 AAATACTTTCTAAGAAACCATGG - Intergenic
1080419395 11:32096491-32096513 GAATAGATTCTATGATGTCAAGG + Intronic
1080716784 11:34810285-34810307 GAATAGATTCTATGAGAGCAGGG + Intergenic
1081013229 11:37842231-37842253 GAAGACATTTTAGGAAAACAAGG - Intergenic
1081457465 11:43238715-43238737 GAATACATTCTAGCACAGTAGGG - Intergenic
1086007621 11:82057140-82057162 GAATACATTCTAAGATACCCAGG + Intergenic
1088534885 11:110849915-110849937 GAATATAAGCTAGTATACCATGG - Intergenic
1091177050 11:133569486-133569508 GAAATAATTCTAGAATACCAGGG + Intergenic
1093975151 12:25413405-25413427 GAATACAGTCTAATATTCCATGG - Intronic
1094390173 12:29940388-29940410 GGATACATTCAATGATTCCATGG - Intergenic
1099669367 12:85670573-85670595 GAATAAATTTTAGGTTCCCAAGG + Intergenic
1099960355 12:89391251-89391273 GAATACACCCAAGCATACCATGG - Intergenic
1100144835 12:91664996-91665018 GAATACAGTCTAGGAGACTGGGG - Intergenic
1101585977 12:106086311-106086333 GCATCCAATCTAGGGTACCACGG - Intronic
1103866664 12:124057702-124057724 CTATACATTCTGGGATGCCAGGG + Intronic
1105522456 13:21142918-21142940 TAATACATTAGAGGCTACCAGGG - Intronic
1106094090 13:26627536-26627558 GAATACATTTGAGGATACATTGG + Intronic
1107945180 13:45411732-45411754 GAATACATACACGCATACCAAGG - Intronic
1111701905 13:91700589-91700611 CATTACATTCTAGTATACCATGG - Intronic
1116659947 14:47697371-47697393 GTATACATTATTGGATTCCAAGG + Intergenic
1117971957 14:61260380-61260402 GAATAAATTCTAGAAGATCATGG + Intronic
1120606484 14:86584508-86584530 GTATACATTCTACAATATCAAGG - Intergenic
1121216771 14:92254537-92254559 GAATGCTTTCAAGGATGCCAGGG + Intergenic
1124698570 15:31889625-31889647 GAGTGCATTTTAGGAAACCAGGG - Intergenic
1128018135 15:64365968-64365990 ATTTACATTCTAGAATACCAGGG + Exonic
1130858711 15:87866264-87866286 GAATGCTTTCTAGGATAAAATGG - Intronic
1131657114 15:94472780-94472802 GAATATATTCTAGGATGGCATGG - Intronic
1150895646 17:69207723-69207745 GAATAGAATCTTGGCTACCAGGG + Intronic
1156500019 18:37551599-37551621 CAATACACTATAGGATTCCAGGG - Intronic
1157345644 18:46829232-46829254 GTATACATTCTAGGTAATCAAGG + Intronic
1158503996 18:58029879-58029901 GAATGCATTCTAGGCTTCCTTGG + Intergenic
1158934371 18:62350951-62350973 TAATACATTAAATGATACCAAGG - Intronic
1164660476 19:29961515-29961537 TAATACATTCTATAATACAATGG - Intronic
1166081362 19:40445755-40445777 GGATCCATTCTAGGATTCCATGG + Intergenic
1166256509 19:41609390-41609412 TAATACATTTTAGGAGGCCAAGG - Intronic
1168398098 19:56065957-56065979 TAATACATTTTAGGAGAACAGGG - Intergenic
928633054 2:33213998-33214020 TAAAACATTCTAGGAATCCAAGG + Intronic
930035984 2:47085501-47085523 GAATACATTCCAGGAGATGATGG + Intronic
934190712 2:89790179-89790201 AAATACATTCAATGATTCCATGG + Intergenic
934965434 2:98717450-98717472 GAGTCCAATCTAGGATCCCATGG - Intronic
936875318 2:117181998-117182020 GAATACATTTTAGAATACAGTGG - Intergenic
939393015 2:141592821-141592843 GAATACACTCCAGAGTACCAAGG - Intronic
940977657 2:159964208-159964230 GAATAGATTAGAGGTTACCAGGG + Intronic
942098693 2:172556799-172556821 GAAAACATTCTAAGAAACCCTGG - Intronic
943506804 2:188770782-188770804 AAATATATTCTTGGATACTATGG + Intronic
946639182 2:221764883-221764905 GACTCCATTGTAAGATACCATGG + Intergenic
1172898658 20:38318312-38318334 GAAAACATTCAAGGAAAGCAAGG + Intronic
1183836237 22:40455791-40455813 ACATACATACTGGGATACCATGG - Intronic
950323909 3:12086537-12086559 CAAAACATCCTAGGATCCCAGGG - Intronic
951970329 3:28437807-28437829 GAATACTTTCAAGAATAACAAGG - Intronic
953067375 3:39486160-39486182 GCATACATTCTAGTTTACCTTGG + Intronic
957201981 3:77147603-77147625 GAAAACATTCTAACATACAACGG - Intronic
974594361 4:63997271-63997293 GTATACATTTTGGGCTACCATGG + Intergenic
976946171 4:90770586-90770608 GAATACACTAAAGGATAGCAAGG - Intronic
980249950 4:130302016-130302038 GATTACATTCTAGGGTACTGGGG + Intergenic
980514862 4:133842144-133842166 TGATAAATTCTAGAATACCATGG - Intergenic
981788387 4:148506198-148506220 GAATACATGTTAGTTTACCAGGG + Intergenic
982430993 4:155321818-155321840 GAATAAATTCTAGGGTAAAAAGG - Intergenic
984016786 4:174436041-174436063 GAATAGATTCCAGGATACTTCGG - Intergenic
986516200 5:8566618-8566640 GAATACATGGTAGGATAGCCAGG - Intergenic
991336747 5:65557164-65557186 GAATACATTCTTGGATTTCAGGG - Intronic
992299288 5:75361792-75361814 AAAAACATTCCAGGAAACCATGG + Exonic
992352784 5:75948213-75948235 GAATACATTTTGGAATTCCATGG - Intergenic
993878187 5:93333095-93333117 GAATAAGTTCTAGTATTCCATGG + Intergenic
996757443 5:126949601-126949623 GAATACATCCTAGGAGGCCCTGG + Intronic
1000203202 5:159032022-159032044 GAATACATTCTTGGATGCTCTGG + Intronic
1006978636 6:38127252-38127274 TAATACATTCTAGGAAAACATGG + Intronic
1008376366 6:50796268-50796290 GAATAAGTTCTAGTGTACCATGG - Intergenic
1012219593 6:96632490-96632512 GAATACAATTTTGGTTACCAGGG - Intergenic
1014320190 6:119918371-119918393 GACTTGATTCTAGGATTCCAGGG + Intergenic
1015177549 6:130327101-130327123 GAATACAGTCTAGGAAAGGAAGG - Intronic
1016473219 6:144397311-144397333 GTAGACATTCTAGGATCCCAAGG + Intronic
1016926270 6:149351734-149351756 GTATAAATTCTAGGATTCCATGG - Intronic
1017289276 6:152716342-152716364 CTATACACTCTATGATACCAAGG + Intronic
1021016902 7:15547120-15547142 GAATACATTCTATGATGCACAGG - Intronic
1021484856 7:21156763-21156785 GAATCCATTCCTGGATGCCATGG + Intergenic
1022660657 7:32363446-32363468 GAATATTTCCTAGGATACAAAGG + Intergenic
1024721788 7:52145080-52145102 GTATCCATTACAGGATACCAAGG + Intergenic
1029375461 7:100174540-100174562 TAATTCATCCTAGGACACCAGGG + Intronic
1029859294 7:103552120-103552142 GAATACACTGGTGGATACCAGGG - Intronic
1032343814 7:131101012-131101034 GAATACATTCCAAGATAAAATGG - Intergenic
1032813270 7:135444411-135444433 GAATATATTCTAATATTCCATGG - Intronic
1033115675 7:138622901-138622923 GAATACTTTCTAGGAAAGAATGG + Intronic
1037985304 8:23287294-23287316 GATTATAATCTAGGAGACCAGGG - Intronic
1038809484 8:30825861-30825883 GAATAAATTACAGGATATCATGG - Intergenic
1041932332 8:63300622-63300644 GTATACCCTCTAGGGTACCAGGG + Intergenic
1043359160 8:79450725-79450747 GTATTCTTTCTAGGATACTATGG - Intergenic
1044572045 8:93730908-93730930 CAACACATTCTGGGAGACCAAGG + Exonic
1045138345 8:99249059-99249081 GATTAGATTAGAGGATACCAGGG - Intronic
1045169470 8:99647973-99647995 GAATACAGTGTAATATACCAAGG + Intronic
1051138570 9:13952404-13952426 GAATACATTATAGAATTCAATGG + Intergenic
1055170519 9:73252876-73252898 GAATATATTCTCTGATACAATGG + Intergenic
1061615917 9:131778809-131778831 GAACACATTCGAAGATTCCAGGG - Intergenic
1193309999 X:79995581-79995603 GAATATAATTTAGGACACCATGG + Intergenic
1195645247 X:107223642-107223664 CAATACATTATAGAATACCATGG + Intronic
1199573642 X:149292096-149292118 GATTACATTCTGAGATACTAGGG + Intergenic
1202113696 Y:21450189-21450211 GAATACATTAAAGCCTACCATGG - Intergenic