ID: 917665237

View in Genome Browser
Species Human (GRCh38)
Location 1:177219866-177219888
Sequence GTATATACAGAGACTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917665232_917665237 -7 Left 917665232 1:177219850-177219872 CCTTAAACCACCCTATGTATATA 0: 1
1: 0
2: 1
3: 13
4: 122
Right 917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 126
917665230_917665237 -1 Left 917665230 1:177219844-177219866 CCCGGGCCTTAAACCACCCTATG 0: 1
1: 0
2: 0
3: 1
4: 83
Right 917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 126
917665231_917665237 -2 Left 917665231 1:177219845-177219867 CCGGGCCTTAAACCACCCTATGT 0: 1
1: 0
2: 0
3: 6
4: 112
Right 917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917665237 Original CRISPR GTATATACAGAGACTCAGCT GGG Intronic
902201142 1:14834520-14834542 AAATATACAGAAAATCAGCTGGG - Intronic
906338527 1:44956649-44956671 GTATATAAATTGACTCAGCTTGG + Intronic
908045387 1:60162786-60162808 GAATATACAGAGACACAGAATGG - Intergenic
908222991 1:62027087-62027109 ATGTATACAGAGATTCAGTTTGG - Intronic
910268721 1:85369302-85369324 ACATATACAGAGAGTCAACTAGG - Intronic
911473037 1:98342128-98342150 ATATATACAAAGACTTAGTTTGG + Intergenic
911815079 1:102339272-102339294 ATGGATACAGAGTCTCAGCTTGG - Intergenic
917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG + Intronic
918840253 1:189526667-189526689 GTATATATAGAGTCTCATCAGGG - Intergenic
919095194 1:193025553-193025575 GTATCAACAGAAACTCTGCTGGG + Intronic
920061636 1:203230823-203230845 GGACATACAGAGACACAGCGAGG - Intronic
921201834 1:212814113-212814135 ATATATACAGAGGTTCAGCCAGG - Intronic
921281624 1:213573388-213573410 GTATGGAAAAAGACTCAGCTTGG + Intergenic
922556227 1:226534412-226534434 TTAAAGACAGAGCCTCAGCTTGG - Intergenic
923111233 1:230892019-230892041 GTATCAACAGAGACTTAACTTGG + Intergenic
1064592614 10:16909898-16909920 GTCTGTACAGAGAGTCAGATAGG + Intronic
1065306594 10:24374966-24374988 GTAGAGACAGAGTCTCAACTAGG + Intronic
1066477603 10:35763195-35763217 GTAAATAGAGAGACCCAGCCAGG - Intergenic
1067009564 10:42697700-42697722 GTCTGTACAGAGAGTCAGATAGG + Intergenic
1067314153 10:45145535-45145557 GTCTGTACAGAGAGTCAGATAGG - Intergenic
1067707087 10:48614683-48614705 GTTCTTACTGAGACTCAGCTGGG - Intronic
1075698801 10:124455129-124455151 GGAGATGCAGAGACTCAGCAGGG + Intergenic
1083349153 11:62014814-62014836 CTATAGACAGAGAAGCAGCTTGG - Intergenic
1085572904 11:77574749-77574771 GAGTATACAGGGACTCACCTAGG + Intronic
1085634055 11:78144367-78144389 GGATAAGCAGAGACTCAGGTAGG - Intergenic
1086399370 11:86448070-86448092 GGAGAGACAGAGGCTCAGCTAGG - Intronic
1087822594 11:102729159-102729181 GCATATAAAGAGAAGCAGCTTGG + Intergenic
1092984180 12:13829344-13829366 GTATATGCAGACACTCTTCTAGG - Intronic
1093028797 12:14269124-14269146 GTCTCTACAGAGACTCTTCTTGG - Intergenic
1097717926 12:62986288-62986310 ATATATACATAGACTCATCATGG - Intergenic
1102049089 12:109849335-109849357 GTATATGCAGATACCCAGTTTGG - Intergenic
1103282849 12:119774811-119774833 GAAAATACAGAAAATCAGCTGGG + Intronic
1105633578 13:22196175-22196197 GTACATACAAAGACTCTTCTCGG + Intergenic
1109144915 13:58767597-58767619 GTAGATACAGAGAGTCGGCAGGG - Intergenic
1113800486 13:113083786-113083808 AAATATAAAGAGACTCAGCCTGG + Intronic
1114275260 14:21137378-21137400 ATATATACAGAGAGACAGCGGGG - Intergenic
1114903937 14:27101256-27101278 ATACATAAAGAGACTCAACTGGG + Intergenic
1114974913 14:28083655-28083677 GAATATACAGTGACTCTGCATGG - Intergenic
1115498678 14:34030400-34030422 GTATGCTCAGAGACTCAACTTGG - Intronic
1117418314 14:55518803-55518825 GTATGTACAGAGATTTATCTGGG - Intergenic
1117742082 14:58828765-58828787 GTAAATAGAGACACTGAGCTTGG - Intergenic
1124035542 15:26050682-26050704 GTAGAAACAAAGACTCAACTTGG + Intergenic
1126135430 15:45385310-45385332 GTGTAAATAGAGAATCAGCTTGG - Intronic
1126303490 15:47226613-47226635 GTCTATACAGAAACTCTTCTTGG - Intronic
1126721581 15:51586676-51586698 GTATATAAATAGACTTAGTTTGG - Intronic
1127968227 15:63939772-63939794 GTATAAACAGAGGCTAAGCTGGG - Intronic
1132235593 15:100218039-100218061 GTATCTACAGAAAATTAGCTGGG - Intronic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1134754648 16:16655931-16655953 ATTTAGGCAGAGACTCAGCTGGG - Intergenic
1134991413 16:18703111-18703133 ATTTAGGCAGAGACTCAGCTGGG + Intergenic
1138414371 16:56862983-56863005 GTATACCCAAAGCCTCAGCTGGG + Intergenic
1140706774 16:77638003-77638025 GTATAAACAGATACACAACTGGG + Intergenic
1141622053 16:85241557-85241579 GTTTATTCAGAGACTCACCAAGG - Intergenic
1144387307 17:14760823-14760845 GTAAGAACAGAGACTCAGCAAGG + Intergenic
1145726518 17:27131167-27131189 GTCTATTCAGAGATTCAACTTGG + Intergenic
1149382045 17:56104203-56104225 GTATACACATACACTCACCTGGG + Intergenic
1152992724 18:377726-377748 GTCTATTCAGAGCCTGAGCTTGG + Intronic
1154253228 18:12761746-12761768 TTATTTAATGAGACTCAGCTAGG - Intergenic
1157530080 18:48412856-48412878 GTATATACAAAGAAACAGCAGGG - Intergenic
1160297249 18:77650100-77650122 AGATATACAGAGACTTAGGTAGG - Intergenic
1164009434 19:21186630-21186652 GTATATACAGAGAATTTGCTTGG - Exonic
1167417274 19:49381542-49381564 ATATACACAGAGACTGAACTGGG + Intergenic
1168058516 19:53877207-53877229 GTATATTCAGAGGCTTAGATTGG - Intergenic
1168123609 19:54270467-54270489 GTATATACACACACACAGCACGG - Intronic
926729277 2:16023166-16023188 GAATACACACAGCCTCAGCTGGG - Intergenic
929800449 2:45095902-45095924 GTATACCCACAGCCTCAGCTAGG - Intergenic
930944314 2:57053444-57053466 TTATAAACAAAGACTCAGCATGG - Intergenic
933849097 2:86351123-86351145 AGATATATTGAGACTCAGCTGGG - Intergenic
941364624 2:164595053-164595075 CTAAATACAGATACTGAGCTGGG - Intronic
941784939 2:169487998-169488020 GTATATAGAGAGCTTCAGTTTGG - Exonic
945662636 2:212705273-212705295 GTATATAAAGTGAATCAGCAGGG + Intergenic
947044664 2:225967793-225967815 GTAGATACAGACACTGATCTAGG + Intergenic
1176678694 21:9805527-9805549 GTGTATCCAGAGACACAGCTCGG + Intergenic
1177573923 21:22925930-22925952 GTATATCCAGATAATCAGTTTGG - Intergenic
1182103087 22:27671073-27671095 GGAGATTCAGAGACTCACCTAGG - Intergenic
1182475966 22:30576526-30576548 GTATTTACTGAGACAGAGCTGGG - Intergenic
949134935 3:553100-553122 GTGTATGCAGAACCTCAGCTTGG - Intergenic
949878755 3:8645223-8645245 TTATATACAGATACTCAGCCTGG + Intronic
952230544 3:31425072-31425094 GTATACACAGAGATTCACTTAGG - Intergenic
952954010 3:38545419-38545441 TTATAAACACAGACTCAGCCAGG - Intergenic
954795313 3:53158413-53158435 ATATATACAGAGCCTCGGCCAGG - Intronic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
960978305 3:123198117-123198139 GTATAATCAGAGACTCAGAAAGG - Intronic
964447015 3:156769978-156770000 GTATATACTGAGACCCTGCTAGG - Intergenic
965966439 3:174496176-174496198 GTATGTGCACAGACTGAGCTGGG - Intronic
970612717 4:17740535-17740557 GTATAAACAGTGGCTCAACTAGG - Intronic
973832125 4:54772221-54772243 GTAGATACAGGGAGACAGCTAGG - Intergenic
974709075 4:65564556-65564578 GTATAAATAGGGACTGAGCTCGG - Intronic
977692667 4:99933236-99933258 ATATATACACACACTCAACTAGG + Intronic
978484698 4:109238757-109238779 GGATATACAGAGAATGGGCTAGG - Intronic
978522964 4:109635591-109635613 GTATATACAGAGACTGAAGGAGG - Intronic
978534883 4:109750396-109750418 CTATATACAAAGACTCAGTATGG - Intronic
981983910 4:150830498-150830520 GTATATATAGTGCCTCAGGTGGG - Intronic
983762557 4:171430117-171430139 ATATAAACAGTGGCTCAGCTAGG - Intergenic
984858741 4:184218347-184218369 GTGTCTACAGAGACACAGCTGGG - Intronic
985396860 4:189553417-189553439 GTGTATCCAGAGACACAGCTCGG - Intergenic
986232029 5:5874384-5874406 TTATATACAGAGATTCCACTTGG + Intergenic
991316584 5:65315611-65315633 ATAAATATAAAGACTCAGCTAGG + Intronic
992313409 5:75526948-75526970 GTAGATAAAGAGAGTCAGCTAGG + Intronic
993719084 5:91304321-91304343 GTGTATACAGAAAGTTAGCTTGG - Intergenic
995071568 5:107928525-107928547 GTACATACAGAAACTCAACCTGG + Intronic
995986028 5:118175114-118175136 GTATTTACACAAACTCAGATGGG + Intergenic
998885040 5:146685299-146685321 GTATAAACAGAGGCTCAGAAAGG - Intronic
998887681 5:146711193-146711215 ATATACTAAGAGACTCAGCTAGG - Intronic
1002882688 6:1266796-1266818 GTCTCTACAGAAAATCAGCTGGG + Intergenic
1006901240 6:37503209-37503231 GCACATACAGAGACCCAGCCTGG + Intergenic
1007217467 6:40251456-40251478 TTCTAAACATAGACTCAGCTAGG + Intergenic
1010471423 6:76232891-76232913 GTATTTACTGAGAATTAGCTGGG - Intergenic
1013291274 6:108720774-108720796 GGATAAAAAGAGAATCAGCTGGG - Intergenic
1015986229 6:138886892-138886914 AGATATACAGAGAATCATCTGGG + Exonic
1017647099 6:156549248-156549270 GTAGAAAGAGAAACTCAGCTGGG - Intergenic
1020473036 7:8561128-8561150 GCACATACAGGGACTCAGCTGGG + Intronic
1028762748 7:94512887-94512909 GGATACACAGTGACTGAGCTAGG + Intronic
1030941761 7:115659699-115659721 GTTTATGGAGAGACTGAGCTTGG + Intergenic
1031507369 7:122602377-122602399 GTATATACAGAAACACACCATGG + Intronic
1034824114 7:154245268-154245290 TTAAATACAGAGACACAGATAGG + Intronic
1038244516 8:25842917-25842939 GTCTATACACAGACTTAGTTTGG - Exonic
1038279047 8:26146940-26146962 GTATATACAGATACTCCTCAAGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1041883240 8:62778049-62778071 GCATATACAGAGACTCTGTCTGG - Intronic
1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG + Intronic
1043651566 8:82600574-82600596 GCATGTACACAGACTCAGCTGGG - Intergenic
1044795111 8:95888885-95888907 GTATATACATTCACTCAGTTTGG - Intergenic
1048366244 8:133741050-133741072 GGACATACAGAGGCTCAGCGAGG + Intergenic
1050894923 9:10874228-10874250 ATATATACACAAACACAGCTGGG + Intergenic
1053390786 9:37734352-37734374 GAACAATCAGAGACTCAGCTTGG - Intronic
1055509997 9:76986639-76986661 ATATATACATACACTCAGCCAGG + Intergenic
1062667824 9:137686674-137686696 GTATAAAAATTGACTCAGCTGGG - Intronic
1062674955 9:137736905-137736927 ATATATACAGAGATTTGGCTGGG + Intronic
1203663864 Un_KI270754v1:8063-8085 GTGTATCCAGAGACACAGCTCGG + Intergenic
1185857849 X:3552452-3552474 ATATATACATAGACACAGTTAGG + Intergenic
1186636074 X:11406323-11406345 GACTATACTGAGCCTCAGCTAGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1192263891 X:69525378-69525400 CTATGGACAGAGACTCATCTTGG + Intronic
1192873514 X:75206632-75206654 GTATATACAGGGAGTATGCTGGG + Intergenic
1193951347 X:87803806-87803828 GAATATACAGAAAATCAGCAAGG + Intergenic
1200219059 X:154381754-154381776 GTATATACAGAGAACCCACTTGG + Intergenic
1201755774 Y:17484068-17484090 GTATATACAGAAACTGGTCTGGG + Intergenic
1201845778 Y:18421917-18421939 GTATATACAGAAACTGGTCTGGG - Intergenic