ID: 917665919

View in Genome Browser
Species Human (GRCh38)
Location 1:177225563-177225585
Sequence CAGTTCCACCAGAAGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917665919 Original CRISPR CAGTTCCACCAGAAGTTGTG AGG Intronic
904909196 1:33921489-33921511 CAGTTCCACCTGGTGTAGTGAGG - Intronic
907255515 1:53175750-53175772 CAATTCCAGCAGAATGTGTGGGG + Intergenic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917791917 1:178504449-178504471 CAGTTCCAGCAGGAGCTCTGGGG - Intergenic
1069431760 10:68342356-68342378 TAGTTCTACAAGAAGTAGTGTGG + Exonic
1073985214 10:109200570-109200592 CAGCTCCACCAGCTCTTGTGGGG + Intergenic
1076001065 10:126913418-126913440 CAGTGCCCCCTGGAGTTGTGTGG - Intronic
1077745958 11:4905920-4905942 CATTTCCAACAGAAATTGGGTGG + Intronic
1081799483 11:45847917-45847939 CCGTTCCACAGGCAGTTGTGAGG - Intronic
1084456269 11:69269860-69269882 CAGGCCCACCAGAGGTTGGGAGG - Intergenic
1086642554 11:89177919-89177941 CAGTTCCTGCAGACCTTGTGAGG + Exonic
1091469391 12:713732-713754 CATTTTCACAAGAATTTGTGTGG - Intergenic
1095214849 12:39536321-39536343 CAGTGCCACCAGAGTTTCTGTGG - Intergenic
1095668627 12:44833065-44833087 CAATTCCACCACCAGTTTTGGGG + Intronic
1096802981 12:54123780-54123802 CTGTTTCAGCAGGAGTTGTGGGG - Intergenic
1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG + Intergenic
1104216279 12:126736870-126736892 CGGTTCCAGCAGAAGTCCTGGGG + Intergenic
1105213837 13:18273262-18273284 CATTTCCACCACAAGTCATGGGG + Intergenic
1106128909 13:26923118-26923140 CCTGTCCACAAGAAGTTGTGAGG + Intergenic
1110191990 13:72740650-72740672 TGGTTCCAACAGAGGTTGTGTGG - Intronic
1113539641 13:111096209-111096231 CCCCTCCACCAGAAGTTGTTTGG + Intergenic
1114474816 14:22986846-22986868 CAGTTCCACCCAAAGCTCTGAGG - Exonic
1117175518 14:53142347-53142369 CAGTTAAACCAGCAGTAGTGGGG - Intronic
1121034896 14:90693742-90693764 CATTCCCACCAGCAGTTATGAGG - Intronic
1122267965 14:100555453-100555475 CACTTCCAACAGAAGGTGGGGGG + Intronic
1122685266 14:103501412-103501434 AAGTGCCACCAGCTGTTGTGGGG + Intronic
1123000866 14:105293421-105293443 CAGTGTCACCAGAACTTGTGGGG - Intronic
1125178328 15:36851788-36851810 CATTTCCACCAAAAGTGCTGGGG - Intergenic
1125332039 15:38591929-38591951 CAGGACAACCAGAAGTTGGGGGG - Intergenic
1128260619 15:66230283-66230305 CGGTTCCACCAGGAACTGTGAGG + Intronic
1129055443 15:72816803-72816825 CTGTTACACCAAAAGGTGTGGGG + Intergenic
1129190424 15:73934255-73934277 CAGTGCCACCAGACGTTTTATGG + Intronic
1133592162 16:7256338-7256360 CATTCCTACCAGAAGTTCTGAGG + Intronic
1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG + Intergenic
1140988533 16:80184973-80184995 GATTTCCACCAGCAGTTGTATGG - Intergenic
1141579101 16:84985079-84985101 CAGTCCCACAAGAAGATGAGTGG - Intronic
1144271531 17:13621941-13621963 GAGTTCCAGCAGAAGTTTTAGGG - Intergenic
1147341074 17:39753736-39753758 AAGTTCCTCCAGTAGATGTGTGG - Intergenic
1148165028 17:45477556-45477578 TAGTTACAACAGAGGTTGTGTGG - Intronic
1150396258 17:64824281-64824303 TAGTTACAACAGAGGTTGTGTGG - Intergenic
1151431339 17:74065532-74065554 CACTTGTACCATAAGTTGTGGGG + Intergenic
1156681927 18:39600716-39600738 CATTTCCTCAAGAACTTGTGTGG - Intergenic
1157974313 18:52309054-52309076 AAGTTGCACCAGAATTAGTGTGG + Intergenic
1159054525 18:63450639-63450661 CAATTACACCAGAATTTCTGGGG + Intergenic
1159766064 18:72489834-72489856 TAGTTCCCCTAGAAGTTATGAGG - Intergenic
1159994686 18:74952796-74952818 CATTTCTCCCAGAAGTTGTGAGG + Intronic
1160953548 19:1679185-1679207 CAGTTTCCCCAGAAGATGGGGGG - Intergenic
1165038232 19:33049953-33049975 CTGTTCCCCCAAAAGATGTGGGG - Intronic
1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG + Intronic
1165896149 19:39142501-39142523 CAGATCCAGCAGAAGTAGGGTGG + Intronic
928861578 2:35863644-35863666 CAGTTCCGACAGAAGTTCTATGG - Intergenic
929024328 2:37585239-37585261 CTGTTCCACCTGAAGATTTGAGG - Intergenic
929386754 2:41416979-41417001 CAGAGCCAACAGAAGATGTGGGG + Intergenic
930296749 2:49563901-49563923 CAGTCCTACCAGCATTTGTGGGG + Intergenic
930972689 2:57416337-57416359 CAGTTTCTCCAGAGGTTATGAGG + Intergenic
931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG + Intergenic
932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG + Intronic
934300489 2:91773487-91773509 CATTTCCACCACAAGTCATGGGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936833522 2:116678911-116678933 CAGCTCCAGCAGTTGTTGTGAGG + Intergenic
937745727 2:125411519-125411541 TACTTCCACCAGAAGTTCTTGGG - Intergenic
938745382 2:134273115-134273137 CATTTCCCCCAGAAGGTGGGGGG + Intronic
942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG + Intergenic
946521432 2:220468979-220469001 AAGTTCCACCACAACTAGTGAGG + Intergenic
947077973 2:226364919-226364941 CAGTTCCACTAGACCTTGTGAGG - Intergenic
948382716 2:237561992-237562014 GAATTCCATCAGAATTTGTGGGG - Intergenic
1170115928 20:12859411-12859433 CAGTTCCACCATACGCTGTAGGG + Intergenic
1171793774 20:29550808-29550830 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1177756499 21:25354996-25355018 CACTTCCCCCAGAAGTTTAGAGG + Intergenic
1178496968 21:33094954-33094976 GAGTCCCACCAGCAGCTGTGAGG + Intergenic
1178863368 21:36307681-36307703 CAGTCTCCCCAAAAGTTGTGAGG - Intergenic
1180606363 22:17061840-17061862 CAGTTACAGCAGAATGTGTGGGG - Intergenic
1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG + Intronic
1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG + Intronic
1181698846 22:24608620-24608642 CATTTCCACCACAAGTCATGGGG - Intronic
1181760039 22:25052011-25052033 CAGCTCCCCCAGCAGCTGTGTGG - Intronic
1183618773 22:38960673-38960695 GAATTCCACCAAAAGTAGTGGGG - Intronic
1183623976 22:38990618-38990640 GAATTCCACCAAAAGTAGTGGGG - Intronic
951748965 3:26012618-26012640 CAGATCAGCCAGAAGGTGTGCGG - Intergenic
952820519 3:37482070-37482092 CAGTGCAGCCAGAAGCTGTGTGG - Intronic
953432928 3:42854507-42854529 CACTTCCACCTCACGTTGTGAGG + Intronic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
961034633 3:123634045-123634067 TAGTTCCATCAGCAGATGTGTGG - Intronic
961172558 3:124808352-124808374 CAGGACCTCCAGAAGATGTGTGG + Intronic
961633759 3:128320124-128320146 TAGTTGCAACAGAGGTTGTGTGG + Intronic
963367865 3:144362152-144362174 CAGTTCTACCAGCAAGTGTGTGG + Intergenic
964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG + Exonic
966704044 3:182891169-182891191 CACTTCCACCTGAAATAGTGGGG + Intronic
976339818 4:83934620-83934642 GAGTTACAGCAGAAGTTGTCAGG + Intergenic
980957082 4:139440357-139440379 CACTTCAACCAGAAGGTGAGGGG + Intergenic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
984764382 4:183388392-183388414 CAGGTCACCCAGCAGTTGTGTGG - Intergenic
985753093 5:1694068-1694090 CAGATCCTCCAGAAGGTCTGAGG - Intergenic
987594493 5:19979375-19979397 CAGTTTCAGCAGAAGGTCTGAGG - Intronic
993839771 5:92863758-92863780 AAATTCTACCAGAAGTTGTGCGG + Intergenic
994998937 5:107102677-107102699 CAGTTCCAGCAGAAGTATTGGGG - Intergenic
998082140 5:139285047-139285069 CAGTCACACGAGAACTTGTGTGG + Intronic
1005173502 6:23015700-23015722 GAGTTCCACAAGAAGTTGCAAGG - Intergenic
1008148968 6:47927057-47927079 CAGTCCCATGAGAAGTTGAGTGG - Intronic
1016066959 6:139693796-139693818 CACTTTCACCTGAAGTAGTGGGG - Intergenic
1021693995 7:23258759-23258781 TAGTTCCATCAGAAGTTATAAGG - Intronic
1022235195 7:28454278-28454300 GACTTCCAACAGAAGTTATGAGG - Intronic
1025728467 7:64089094-64089116 CATCTCCAGCAGAAGTTGAGTGG + Intronic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1028107355 7:86894928-86894950 CACTTCTATCACAAGTTGTGCGG + Intronic
1034104844 7:148481610-148481632 CAGCCCATCCAGAAGTTGTGGGG - Intergenic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1043968334 8:86504253-86504275 TAGATCCTCCAGCAGTTGTGGGG + Intronic
1045429205 8:102097544-102097566 CTGTTTCATCAGAAGTTGCGTGG + Intronic
1046937417 8:119898162-119898184 TAGTTGCAACAGAAATTGTGTGG + Intronic
1046969250 8:120203302-120203324 CAGGTCCACCAGAAGTGGGGAGG + Intronic
1048199743 8:132362445-132362467 CAGTTCCAGCAGAAACTGAGAGG + Intronic
1048605013 8:135958951-135958973 CATTTCCACCAGAGTTTTTGGGG - Intergenic
1048804630 8:138228658-138228680 AAGAGCAACCAGAAGTTGTGGGG - Intronic
1050000324 9:1070609-1070631 CAGTTCTACTTGAAGTTGTTAGG + Intergenic
1050052662 9:1619460-1619482 CAGTTCCACATGGAGTTGTGAGG + Intergenic
1051797262 9:20886543-20886565 CAGTGGCATCAGAAGTTATGAGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054152655 9:61617957-61617979 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055156272 9:73066702-73066724 CAGTTCCTTCAGAAGGTCTGTGG - Intronic
1058175114 9:101726424-101726446 CTGTACCACCAGAAGGTGTTTGG - Intronic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1062666129 9:137673615-137673637 CAGTTTCGCCAGGAGTTGTCTGG - Intronic
1187291208 X:17955177-17955199 CAGTTGCTACAGGAGTTGTGAGG - Intergenic
1188054078 X:25521672-25521694 CAGTTTCATCAGAATTTGTGGGG - Intergenic
1190913442 X:54792275-54792297 CAGATCCACCATATGCTGTGTGG - Intronic
1194657892 X:96595761-96595783 CAGTGCAACTAGAATTTGTGAGG - Intergenic
1195071719 X:101287609-101287631 CAGTACTACCAGAAGTGGTCAGG - Intronic
1195673403 X:107487687-107487709 CAGTTACACCAGAATCTCTGTGG + Intergenic
1196685862 X:118509798-118509820 CACTTCCTCCAGAAGCTGTAGGG + Intronic
1198432928 X:136586061-136586083 GAGTTCCACCAGTAGTTAAGAGG + Intergenic
1198998671 X:142606666-142606688 CAGGTCCACCCGAAGTTGTCCGG - Intergenic