ID: 917668533

View in Genome Browser
Species Human (GRCh38)
Location 1:177249353-177249375
Sequence ATTCACATTGCACATATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 290}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917668533_917668537 3 Left 917668533 1:177249353-177249375 CCCTTTATATGTGCAATGTGAAT 0: 1
1: 0
2: 1
3: 13
4: 290
Right 917668537 1:177249379-177249401 TTTTACAGGCAAAGTCCACAGGG 0: 1
1: 0
2: 1
3: 12
4: 187
917668533_917668541 25 Left 917668533 1:177249353-177249375 CCCTTTATATGTGCAATGTGAAT 0: 1
1: 0
2: 1
3: 13
4: 290
Right 917668541 1:177249401-177249423 GAAGGGCTCTCTTTACCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 194
917668533_917668539 8 Left 917668533 1:177249353-177249375 CCCTTTATATGTGCAATGTGAAT 0: 1
1: 0
2: 1
3: 13
4: 290
Right 917668539 1:177249384-177249406 CAGGCAAAGTCCACAGGGAAGGG 0: 1
1: 0
2: 4
3: 28
4: 308
917668533_917668536 2 Left 917668533 1:177249353-177249375 CCCTTTATATGTGCAATGTGAAT 0: 1
1: 0
2: 1
3: 13
4: 290
Right 917668536 1:177249378-177249400 ATTTTACAGGCAAAGTCCACAGG 0: 1
1: 0
2: 1
3: 11
4: 189
917668533_917668538 7 Left 917668533 1:177249353-177249375 CCCTTTATATGTGCAATGTGAAT 0: 1
1: 0
2: 1
3: 13
4: 290
Right 917668538 1:177249383-177249405 ACAGGCAAAGTCCACAGGGAAGG 0: 1
1: 0
2: 0
3: 31
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917668533 Original CRISPR ATTCACATTGCACATATAAA GGG (reversed) Intronic
901698595 1:11030439-11030461 ATTCAAGTTACACATCTAAAAGG - Intronic
902102741 1:14005827-14005849 ATTCACACTGCTCCTATCAATGG + Intergenic
903310350 1:22450824-22450846 ATTGACATTGCAGATGGAAAAGG + Intergenic
903353489 1:22732138-22732160 ATTCCCACTGCACAGATAAGGGG - Intronic
907174826 1:52509642-52509664 ATTCACATTGAAAATATCCAGGG - Exonic
908180744 1:61602758-61602780 AATTAAATTACACATATAAATGG + Intergenic
909636584 1:77823383-77823405 AAACACATTGCACACTTAAAGGG + Intronic
910063377 1:83120892-83120914 TGTCCCATTTCACATATAAATGG + Intergenic
910302881 1:85727510-85727532 CATCACATTCCACAGATAAATGG + Intergenic
910455033 1:87388561-87388583 ACTCACAATGAAGATATAAAAGG - Intergenic
911116982 1:94256351-94256373 AAACACTTTGCACATACAAATGG + Intronic
911162786 1:94698292-94698314 ATTGTCATTGTACATATTAATGG - Intergenic
911574334 1:99557156-99557178 ACTCACTTTGGACATATAAACGG + Intergenic
911726620 1:101248178-101248200 ATTCACTTTGCACGTGTGAATGG - Intergenic
911787930 1:101974043-101974065 ATTTACAATGCATATATACAAGG + Intronic
912149092 1:106834375-106834397 ATTCCCCTTTCACATAAAAAAGG - Intergenic
916097356 1:161363062-161363084 ATTATCATTGAACATATTAATGG + Exonic
917668533 1:177249353-177249375 ATTCACATTGCACATATAAAGGG - Intronic
918034933 1:180859335-180859357 ATTCATATTGGACATATTTATGG - Intronic
918964975 1:191331672-191331694 AGTCACATTGCTAATAAAAATGG - Intergenic
919199823 1:194342221-194342243 ATATACATTACATATATAAAAGG - Intergenic
921689179 1:218128370-218128392 AATCACATTGCAGAATTAAAGGG - Intergenic
921896745 1:220409861-220409883 ATTCACAATGCACAAACCAAGGG - Intergenic
922413890 1:225401900-225401922 ATTAACACTGCATATCTAAATGG + Exonic
922928390 1:229369803-229369825 ATTCACAATGTAAATTTAAAAGG - Intergenic
923876642 1:238056796-238056818 ATTCACATTTTACATGTGAACGG - Intergenic
1064736775 10:18389972-18389994 ATTTTCTTTGCATATATAAAAGG - Intronic
1064946847 10:20800189-20800211 TTTCAGATTCCACATATAAGTGG + Intronic
1065666670 10:28070699-28070721 ATACACACTGGACATATATAAGG + Intronic
1067310626 10:45110237-45110259 TTTTACATTCCACATATAAGTGG + Intergenic
1067993658 10:51244327-51244349 ATTCACCTTGACAATATAAATGG - Intronic
1068050163 10:51940433-51940455 ATTCACATATCACATCAAAAGGG - Intronic
1068405458 10:56582752-56582774 AATTCCATTGTACATATAAATGG + Intergenic
1068425498 10:56856921-56856943 ATGAAGACTGCACATATAAATGG - Intergenic
1068687761 10:59887053-59887075 ATTCGAATTACACATATATAGGG + Intronic
1069055550 10:63840752-63840774 ATAAACATTGCCCAAATAAATGG - Intergenic
1069301205 10:66910006-66910028 ATTTATATGGCATATATAAATGG + Intronic
1069819600 10:71219146-71219168 AGTGAGACTGCACATATAAAAGG - Intronic
1070111366 10:73490133-73490155 ATAAACACTGCACAAATAAATGG + Intronic
1072090219 10:92119778-92119800 ATTATCATTGAACATATTAAAGG + Intronic
1072419979 10:95282241-95282263 GTTCAAATTCCACATGTAAATGG - Intronic
1074170051 10:110924347-110924369 ACTCACACTGCACGTATAACTGG + Intronic
1074397040 10:113106732-113106754 ATTCAAAATACACACATAAATGG - Intronic
1075279277 10:121125861-121125883 ATTCATTTTTCATATATAAATGG - Intergenic
1078583125 11:12555426-12555448 TTTCAGATTTCACATATAAGTGG - Intergenic
1079084413 11:17435039-17435061 ATTATCATTGAACATATTAAAGG - Intronic
1081117510 11:39222362-39222384 ATTAACATTGGAGATAGAAAAGG + Intergenic
1081369521 11:42283116-42283138 ATACAAATTGCACATATTTAAGG - Intergenic
1081397762 11:42606926-42606948 TTTCAGGTTGCATATATAAATGG + Intergenic
1082652664 11:55812886-55812908 ATACACATTATACATATATATGG - Intergenic
1083110514 11:60401612-60401634 ATCCACATTTTACAGATAAATGG - Intronic
1086734736 11:90291940-90291962 ATTCAGATTACACATACTAATGG - Intergenic
1086774379 11:90812096-90812118 ATTCATATTGCAAAAGTAAAAGG + Intergenic
1086968073 11:93051038-93051060 ATTCACACAGCAGATATAAACGG - Intergenic
1087843826 11:102948834-102948856 CTCCAAATTGAACATATAAAAGG - Intronic
1088315845 11:108505671-108505693 ATTTACACTGTACATTTAAATGG + Exonic
1092555210 12:9552350-9552372 ATTTATATTGCAAAGATAAATGG - Intergenic
1092606632 12:10127580-10127602 ATGCCCATTTCACTTATAAAGGG - Intronic
1092962994 12:13614095-13614117 AATCACATTTCACATAAAATTGG + Intronic
1093177462 12:15928789-15928811 TTTTAAACTGCACATATAAAGGG - Intronic
1094516886 12:31138332-31138354 ATTTATATTGCAAAGATAAATGG + Intergenic
1095134418 12:38582164-38582186 ATTTAAATTACACAAATAAAAGG - Intergenic
1098633637 12:72754836-72754858 AATGAGATTACACATATAAAGGG - Intergenic
1099556793 12:84119019-84119041 ATTCACATTTCACATTTCTAAGG - Intergenic
1100989588 12:100237971-100237993 ATTCACACTGAACATTAAAATGG + Intronic
1104346008 12:127999468-127999490 TTTCACATTATACATATAGATGG + Intergenic
1108827798 13:54436471-54436493 ATTAACATTGCAGATGGAAATGG + Intergenic
1110605206 13:77424349-77424371 ATACACATTGTACATATTTATGG + Intergenic
1110944262 13:81393114-81393136 ATGCAGATTTCATATATAAATGG - Intergenic
1111874346 13:93874548-93874570 CTTCTCATTGCAAATAGAAAGGG + Intronic
1111904964 13:94244652-94244674 ATTCTCATCTCTCATATAAATGG - Intronic
1112993249 13:105540206-105540228 ATTGACATTGTACAAAGAAAAGG + Intergenic
1115586853 14:34822654-34822676 ATTCACTTTTCTCATATCAAGGG + Intronic
1116310625 14:43321797-43321819 TTTTATATTGCACATATAAATGG - Intergenic
1116473630 14:45314690-45314712 ATTATAATTGCTCATATAAAGGG - Intergenic
1116799096 14:49424237-49424259 ACATACATTGCAAATATAAAGGG + Intergenic
1117235824 14:53773670-53773692 ACTCACATCGAAAATATAAAGGG + Intergenic
1117581638 14:57157345-57157367 ATTCTCATTGCACACATCCAAGG - Intergenic
1119625304 14:76169139-76169161 AAACACATGGCACATTTAAATGG - Intronic
1120533652 14:85665198-85665220 ATACAAATGGCACATATACACGG + Intergenic
1123139903 14:106065330-106065352 ATTCACATTTCAAAGAAAAATGG + Intergenic
1202936945 14_KI270725v1_random:97579-97601 ATTCATATTGTAAATATAGAGGG - Intergenic
1123683405 15:22780099-22780121 TTTTACATCCCACATATAAATGG + Intronic
1125254057 15:37742512-37742534 ATGCCCATTGAACAAATAAAAGG - Intergenic
1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG + Intronic
1126772759 15:52074056-52074078 ATACACTTTGCAGATATTAAAGG + Intergenic
1126934975 15:53696770-53696792 ATTAAAATTGCACAGATTAAAGG + Intronic
1127675613 15:61235502-61235524 AATCACATTGAACACATACATGG - Intergenic
1130647225 15:85739404-85739426 ATTTACATTAGAAATATAAATGG - Intronic
1131585560 15:93689357-93689379 ATTCACATTGAAGATGTAGACGG + Intergenic
1137328310 16:47463300-47463322 ATGCACTTTGCACATAAAAGTGG - Intronic
1138682831 16:58698586-58698608 ATTTACATGGCACTTAAAAATGG - Intergenic
1139090957 16:63646768-63646790 ATACACAATAAACATATAAATGG + Intergenic
1139241380 16:65395752-65395774 ATTCACATTTTACACATAAGAGG - Intergenic
1140582171 16:76243993-76244015 AATCACATTGCATATATTCAGGG - Intergenic
1141074759 16:80994459-80994481 ATTCACAATACACTTATCAAAGG + Intronic
1141389574 16:83653263-83653285 ATTTAAATTGTACATATGAATGG - Intronic
1141845996 16:86609559-86609581 CTTCACATCGCTAATATAAATGG - Intergenic
1142730965 17:1857389-1857411 ATTATCATTGAACATATTAATGG - Intronic
1148998733 17:51735177-51735199 TTCCACATTGCATATATACAGGG - Intronic
1150063689 17:62090921-62090943 TTTGGCATTGCACATCTAAAAGG - Intergenic
1151104432 17:71595887-71595909 AATAACATTCTACATATAAAAGG - Intergenic
1151763468 17:76120590-76120612 AGTGACATGGCGCATATAAAAGG + Intronic
1152328435 17:79656275-79656297 ATTGACAATGCACACATTAATGG + Intergenic
1153349728 18:4065825-4065847 ATTCACATGGAACAAAAAAAGGG + Intronic
1158784557 18:60693876-60693898 ATGCACATTACATACATAAAGGG + Intergenic
1162257574 19:9503857-9503879 ATTTTCATTGTACATATTAATGG + Intergenic
1162389058 19:10378213-10378235 ATCCACATTGCACATAAAGTTGG - Exonic
1163045835 19:14641188-14641210 ATTCATATTTCATATATACATGG - Intronic
1164335629 19:24316961-24316983 ATTCATCTTGCAAAGATAAATGG + Intergenic
1168437039 19:56326544-56326566 TTTAATATTCCACATATAAATGG + Intronic
925503313 2:4531436-4531458 ATTCACATATTAAATATAAATGG - Intergenic
926103976 2:10138793-10138815 ATTCAGTTTGCCCATCTAAAGGG + Intergenic
929326804 2:40623318-40623340 GTATACGTTGCACATATAAATGG - Intergenic
930709235 2:54534535-54534557 ATTTATTTTTCACATATAAATGG + Intronic
930876357 2:56222309-56222331 ATTGACATTGTACATATTTAAGG + Intronic
931057112 2:58484848-58484870 AGTCACATTGCTAATAAAAAGGG + Intergenic
932440246 2:71730286-71730308 CTTCACATTGCAGTTGTAAATGG + Intergenic
933641172 2:84761932-84761954 ATTCACATTGTAGATATTATAGG + Intronic
934039949 2:88119770-88119792 CTTCACATTGAAAATATTAATGG + Intergenic
935856697 2:107282366-107282388 ATTCACATTTCCCATAGATAAGG + Intergenic
937581663 2:123495783-123495805 AAGCACATTGCACAAATAAGAGG + Intergenic
937811080 2:126200056-126200078 ATACACATTACATATATATATGG + Intergenic
938990683 2:136626053-136626075 CTTCACTTTGCAAAGATAAATGG - Intergenic
940101594 2:150046323-150046345 AAACACAATGCACATACAAATGG - Intergenic
940566990 2:155377715-155377737 CTTTACTTTTCACATATAAATGG + Intergenic
941086482 2:161124114-161124136 ATTCAAATAGCACAGATAAAAGG + Intergenic
942209498 2:173656407-173656429 AATCAGATTTCACATAAAAATGG + Intergenic
942901264 2:181121892-181121914 ATTCAAAATGCTCAAATAAAAGG - Intergenic
943964531 2:194316222-194316244 ATTAACATTGAACATTAAAAAGG - Intergenic
944839151 2:203608695-203608717 ACTCACATTGAAGATATAAAAGG - Intergenic
944917870 2:204379268-204379290 ATTCATATTGCCCATATATTTGG - Intergenic
944993155 2:205261114-205261136 ATTAAAAATGCACATTTAAATGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945745627 2:213717469-213717491 ATTCACACTGGAGATAGAAAAGG - Intronic
947384676 2:229579150-229579172 ATTCTCCTTGGACATACAAAGGG - Intronic
1169929223 20:10814212-10814234 GTTCATATTGCACATAGAAGAGG - Intergenic
1169930249 20:10824975-10824997 GATCACATTGCAGATATGAAAGG - Intergenic
1170118161 20:12883575-12883597 ATGCACATGGCACATATACCTGG + Intergenic
1170256231 20:14347288-14347310 ATTCATAATGCACATATGAGAGG + Intronic
1176523107 21:7839691-7839713 ATTCCTATTACACATATAATAGG - Intergenic
1176586373 21:8591398-8591420 ATTCATATTGTAAATATAGAGGG + Intergenic
1176743076 21:10624118-10624140 ATTCATATTGTAAATATAGAGGG + Intergenic
1176877996 21:14153419-14153441 ATTCACCTTGCCCATATAAATGG + Intronic
1177623102 21:23622268-23622290 ATTTACATTTCACAAGTAAAAGG - Intergenic
1177901469 21:26922025-26922047 ATTCTCTTTGCACAGACAAATGG + Exonic
1177928446 21:27249298-27249320 ATGTACATTGCACATACTAAAGG + Intergenic
1178203587 21:30437050-30437072 ATCCACATGGCACATAAAATAGG + Intergenic
1178375705 21:32065870-32065892 AGCCACATTACACATATAATCGG + Intergenic
1178657127 21:34469703-34469725 ATTCCTATTACACATATAATAGG - Intergenic
1180269180 22:10568301-10568323 ATTCATATTGTAAATATAGAGGG + Intergenic
1182403629 22:30104767-30104789 ATTCAATTTGCAGATATGAAAGG + Intronic
1182662290 22:31933577-31933599 ATTCCCATTTCACAGATAAGGGG + Exonic
1183003119 22:34878127-34878149 AGTCACATTGCCCCTATAAGAGG + Intergenic
1184082009 22:42228663-42228685 ATTCCCATTGCACATCCACATGG + Intronic
950603227 3:14054836-14054858 AATAACATAGCACCTATAAAAGG - Intronic
951287437 3:20831563-20831585 ATGCACATTTCACATACAAAAGG + Intergenic
952135962 3:30420015-30420037 CTTTACATTCCACATATAAGTGG - Intergenic
952382073 3:32813161-32813183 ACTTGAATTGCACATATAAAAGG - Intergenic
955784193 3:62519057-62519079 ATTCAAGTTGAAAATATAAAGGG + Intronic
956961291 3:74404344-74404366 ATACACATTGTATAAATAAAAGG + Intronic
957027680 3:75202383-75202405 ATACACATTGCAAAAATAATTGG - Intergenic
957369466 3:79273760-79273782 AAGCACATTTCACCTATAAAAGG + Intronic
957733507 3:84176120-84176142 ATTCACATGGCACCAAAAAAGGG + Intergenic
957992541 3:87645438-87645460 ATCCAGAATGCACATTTAAATGG - Intergenic
958504220 3:94953712-94953734 ATTCAAATTCCATAAATAAAGGG - Intergenic
958965479 3:100553404-100553426 ATTTATCTTGCAAATATAAATGG - Intronic
959972760 3:112425491-112425513 CTTCACATTACAGAAATAAAAGG - Intergenic
960189718 3:114688608-114688630 GTACACATTGCACATAAAACAGG - Intronic
960308813 3:116095593-116095615 ATTCACATAGAAGAAATAAATGG + Intronic
962130058 3:132663006-132663028 ACTCCCATTGAAAATATAAAGGG + Intronic
962185457 3:133254375-133254397 ATTCATATTGCATATTTAATAGG - Intronic
965670110 3:171139199-171139221 ATTCAAGTTGTACAAATAAATGG + Intronic
966058346 3:175724885-175724907 TTTCAACTGGCACATATAAAAGG + Intronic
966144849 3:176799144-176799166 ATACTCAATACACATATAAAAGG - Intergenic
966630116 3:182063249-182063271 ACTCACCTTGCAAATAAAAAAGG + Intergenic
967261381 3:187646024-187646046 TTTCACACTTCACATATAAATGG + Intergenic
967601663 3:191397730-191397752 ATCCACATTCCAAATATCAAAGG - Intronic
969959710 4:10932175-10932197 ATTCACTATGCACATATAAGTGG - Intergenic
970648700 4:18153667-18153689 TTTCAGATGGCACAAATAAATGG + Intergenic
971691975 4:29848628-29848650 CTTCATATTGCAAAAATAAATGG - Intergenic
972902793 4:43705492-43705514 ATTCAGAATACACTTATAAATGG + Intergenic
973590837 4:52439547-52439569 ATTCAACTGGAACATATAAAAGG + Intergenic
974473718 4:62353123-62353145 ATTAACATTCAACATATACAAGG - Intergenic
975502503 4:75101984-75102006 ATTAACATAGCACAAATCAAAGG + Intergenic
975777967 4:77809251-77809273 ATTTAGATTACACATTTAAAGGG + Intronic
976092526 4:81472687-81472709 CTTCACTTTGTACACATAAAAGG + Intronic
977025703 4:91816623-91816645 ATGTACATCCCACATATAAATGG - Intergenic
977967055 4:103165214-103165236 ATTTAAATTGCAGATTTAAATGG + Intronic
978122866 4:105102080-105102102 ATTAACATTGCAGATAAAGATGG + Intergenic
978701214 4:111648630-111648652 ATTCACCTTACAAAGATAAAAGG + Intergenic
980172823 4:129310523-129310545 ATTCACATTGCACTGGTAATAGG - Intergenic
981271381 4:142850229-142850251 AGTCACATTTCAAATATAATAGG + Intergenic
981320953 4:143390722-143390744 TTTTATATTGCTCATATAAAAGG + Intronic
983433083 4:167675994-167676016 TTTCACTTTGCAGATATAAAGGG - Intergenic
984688049 4:182693758-182693780 ATTCACATTTCATATAAAACAGG - Intronic
987785696 5:22495792-22495814 ACTCACATTGCAATTATTAAGGG - Intronic
988878545 5:35474718-35474740 ATTAACATTTCACATTAAAATGG + Intergenic
990211691 5:53487046-53487068 ATATACATTGCACATTTACATGG - Exonic
991931634 5:71758551-71758573 TTTGAGATTCCACATATAAATGG + Intergenic
993038114 5:82779835-82779857 ATTCAATTTTTACATATAAATGG - Intergenic
993533772 5:89055720-89055742 ATTCAGATTACACAAATAAAGGG + Intergenic
993570759 5:89535967-89535989 CTTCACATTTCACAATTAAAAGG + Intergenic
993678256 5:90844145-90844167 TTTCATATGGCATATATAAATGG - Intronic
993748218 5:91629088-91629110 ATACACTTTGCTTATATAAATGG - Intergenic
994319486 5:98375791-98375813 ATTCATATAGCAAATATAGATGG - Intergenic
994902101 5:105786724-105786746 ATTCAAATTTCACAGTTAAATGG - Intergenic
996144982 5:119963641-119963663 AATTACATTGCACAGATATATGG + Intergenic
996546635 5:124686058-124686080 ATTCAAATGCCAAATATAAAGGG + Intronic
996915683 5:128709543-128709565 ATCCACATGGCATAGATAAAGGG + Intronic
997310847 5:132880866-132880888 TTTCACATTGGAAATATTAAAGG + Exonic
997410401 5:133686660-133686682 ATCCCCATTTCACATACAAAGGG + Intergenic
997712062 5:136014162-136014184 ATTTATATTACACATTTAAAAGG - Intergenic
998766482 5:145493363-145493385 TTTCACTTTGCTCATCTAAATGG + Intronic
999089512 5:148923346-148923368 ATGCACATTGTACATATCACTGG - Intergenic
1000253635 5:159518047-159518069 ATTCACATTTCACACATGGATGG - Intergenic
1000698412 5:164418470-164418492 ATTCACATTTCAGCTATAACAGG - Intergenic
1001098944 5:168798061-168798083 ATACACATAAGACATATAAATGG + Intronic
1003048486 6:2758661-2758683 ATTTAGAGTGCACATGTAAATGG - Intergenic
1003642340 6:7886573-7886595 TTTTACATTGAACATAAAAATGG + Intronic
1003892314 6:10574452-10574474 ACCCAGATGGCACATATAAAGGG + Intronic
1003976518 6:11350146-11350168 ATTTACATGGCATATAAAAAAGG + Intronic
1004454853 6:15782946-15782968 ATCCACAACCCACATATAAATGG + Intergenic
1005649636 6:27874749-27874771 ATACACATTTGAAATATAAAAGG - Intergenic
1007172598 6:39874499-39874521 ATTCACATTGCCCATGGAACAGG - Intronic
1008035233 6:46738203-46738225 ATTCAGATTTCAGATTTAAATGG - Intergenic
1009896923 6:69763301-69763323 ATCCACATTGCAAAAAAAAATGG + Intronic
1010536113 6:77033164-77033186 ATTAAAATTGTAAATATAAATGG + Intergenic
1011855165 6:91680857-91680879 ATTTACATTCCACAGAGAAATGG - Intergenic
1011878692 6:91995523-91995545 AATTACATTGCAAATATACAAGG + Intergenic
1011974235 6:93274096-93274118 TTTCAAATGGCACACATAAATGG - Intronic
1012213368 6:96551970-96551992 ATTCAAATTTCAGATATGAAAGG - Intronic
1012529511 6:100217780-100217802 ATACAGATTGCAAATACAAAAGG + Intergenic
1013705765 6:112832284-112832306 ATTGACATTGCACATAATTAAGG - Intergenic
1014313898 6:119839534-119839556 TTTTACATTCCACATATAAGTGG + Intergenic
1014617165 6:123617662-123617684 TTTCAGATTGCTAATATAAAAGG + Intronic
1014715985 6:124864801-124864823 CTTCACATTTGACATATGAAAGG - Intergenic
1014836700 6:126168008-126168030 GTTCACATTCCAGCTATAAATGG - Intergenic
1015302120 6:131665557-131665579 ATTGATACTGCAGATATAAAAGG - Intronic
1015751828 6:136568140-136568162 AGTCACATTGCACATATGTGGGG + Intronic
1015847754 6:137538671-137538693 CTTCAGATTACACATATAAAAGG + Intergenic
1016196990 6:141356216-141356238 ATATATATTGCACATATATATGG + Intergenic
1017300960 6:152856956-152856978 GTTTACATTGCTCATATAAGGGG - Intergenic
1017982237 6:159409928-159409950 TTTCACACTTCACAAATAAAAGG - Intergenic
1019618161 7:1976096-1976118 ATTCACATACAACAAATAAATGG + Intronic
1020674116 7:11159850-11159872 ATTCAAAATGCAAATAAAAAGGG + Intronic
1020706000 7:11545066-11545088 ATACACATTTCATATAAAAATGG + Intronic
1021134278 7:16946867-16946889 AATCACAGTGCATAAATAAAAGG - Intergenic
1021535874 7:21703718-21703740 AGTCATATTGCACATACACATGG - Intronic
1023086457 7:36574362-36574384 ATTCAGATTGCAAAGATAAAAGG - Intronic
1023988607 7:45113590-45113612 CTGGACATTGCAAATATAAATGG - Intergenic
1024004355 7:45214563-45214585 ATCCACATTTCACACATGAAAGG + Intergenic
1025838455 7:65119792-65119814 ATTCATATTGTACGTATATAGGG + Intergenic
1025878822 7:65513304-65513326 ATTCATATTGTACGTATATAGGG - Intergenic
1025884617 7:65576189-65576211 ATTCATATTGTACGTATATAGGG - Intergenic
1025921903 7:65921218-65921240 AATTAAATTGAACATATAAAAGG - Intronic
1026518291 7:71092326-71092348 AATCAAATACCACATATAAATGG + Intergenic
1027660787 7:80986112-80986134 GTCCACATGGCACAGATAAAAGG + Intergenic
1028603311 7:92627228-92627250 ATTTACATTGTCTATATAAATGG - Intronic
1028864426 7:95691415-95691437 ATTCACATTACACACTTAACAGG - Intergenic
1029893519 7:103957128-103957150 ATTCTCATTGGAAATATTAATGG + Intronic
1033918906 7:146363113-146363135 ATTTACATAGCACTTATAATAGG + Intronic
1035920491 8:3670593-3670615 ATATATATTGCACATATATATGG + Intronic
1036066054 8:5382749-5382771 ATTCAAATTCCACAAATAAGAGG - Intergenic
1037089609 8:14897580-14897602 ATTCACATTTAAAATAGAAAAGG - Intronic
1038057984 8:23880033-23880055 ATTCACAATGAATATTTAAATGG - Intergenic
1041191585 8:55361043-55361065 AGTCACATTGGACATATTACAGG + Intronic
1041504092 8:58575088-58575110 TTTCAGATTCCACATATAAGTGG + Intronic
1043096254 8:75978255-75978277 ATTCATATTGCATAAATACAAGG + Intergenic
1043484890 8:80689088-80689110 ATTCAAAATGCACATAAATATGG - Intronic
1043656876 8:82678575-82678597 ATTAAAATTGCACAGATAAGAGG + Intergenic
1043761471 8:84074457-84074479 ATTCACATTGCTGAGAGAAAAGG - Intergenic
1044008116 8:86962184-86962206 ATTCTTATTGCACACATGAAGGG - Intronic
1045852703 8:106722295-106722317 AATCACATTTCTCAGATAAAGGG + Intronic
1045931964 8:107637875-107637897 ATTCATATTTCAGATATAAAAGG + Intergenic
1046490204 8:114942596-114942618 ATTAATATTGCACATAACAAAGG + Intergenic
1048760328 8:137787550-137787572 ATGTACATTTCACATATACATGG + Intergenic
1048761306 8:137798562-137798584 ATTCACATTTTACATGTGAATGG + Intergenic
1053540466 9:38968515-38968537 ATCCACATTTCACATGTCAAAGG - Intergenic
1053804815 9:41790671-41790693 ATCCACATTTCACATGTCAAAGG - Intergenic
1054140470 9:61524793-61524815 ATCCACATTTCACATGTCAAAGG + Intergenic
1054625674 9:67395408-67395430 ATCCACATTTCACATGTCAAAGG + Intergenic
1056400707 9:86224628-86224650 ATTGTCATTGTACATATATATGG - Intronic
1059831539 9:118101659-118101681 ATTCAAGCTGCACATAAAAAAGG + Intergenic
1060706608 9:125807575-125807597 ATTCACATTTCTAATCTAAAAGG + Intronic
1203793191 EBV:162396-162418 ATTCTCATAGCACATACAGATGG + Intergenic
1203616272 Un_KI270749v1:68908-68930 ATTCATATTGTAAATATAGAGGG + Intergenic
1185637846 X:1567348-1567370 ATTTATATTGCAAATATATATGG + Intergenic
1185894695 X:3847239-3847261 ATTCACAAGGCACATAAACAGGG + Intergenic
1185899813 X:3885664-3885686 ATTCACAAGGCACATAAACAGGG + Intergenic
1185904929 X:3924092-3924114 ATTCACAAGGCACATAAACAGGG + Intergenic
1187135408 X:16542800-16542822 ATTCCCATAGCACATTTTAATGG + Intergenic
1187505080 X:19872859-19872881 ACACACAGAGCACATATAAAAGG + Intronic
1188528255 X:31109052-31109074 TTTCACAATGAGCATATAAATGG + Intronic
1189793024 X:44621300-44621322 AATCATATTGCACATAAAGATGG + Intergenic
1191199213 X:57761098-57761120 GTACACATTGCACATATTTAGGG - Intergenic
1192093634 X:68186921-68186943 AGTCACTTTCAACATATAAATGG + Intronic
1195115116 X:101689479-101689501 ACTCACATTAAACAGATAAAAGG - Intergenic
1195472829 X:105251978-105252000 AATCAAATTGTACATGTAAAAGG - Intronic
1196535895 X:116843961-116843983 TTTCAAATTACACATATGAAAGG + Intergenic
1196963158 X:121026032-121026054 ATTCACATTTGTCACATAAATGG + Intergenic
1197630766 X:128855092-128855114 TTTCAGATTCCACATACAAATGG - Intergenic
1197711552 X:129674718-129674740 ATTCCAATTACACATATAAGAGG + Intergenic
1200378026 X:155804746-155804768 ATTCAAATTGCATATATTCAAGG + Intergenic
1200388988 X:155924215-155924237 ATACAAATTGCCCATTTAAAGGG + Intronic