ID: 917669720

View in Genome Browser
Species Human (GRCh38)
Location 1:177261965-177261987
Sequence CCTCCATGTCACCAAATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917669720_917669724 2 Left 917669720 1:177261965-177261987 CCTTCAATTTGGTGACATGGAGG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 917669724 1:177261990-177262012 ACTGGTAACCTGGAGAAGAGTGG 0: 1
1: 0
2: 5
3: 25
4: 254
917669720_917669723 -8 Left 917669720 1:177261965-177261987 CCTTCAATTTGGTGACATGGAGG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 917669723 1:177261980-177262002 CATGGAGGTCACTGGTAACCTGG 0: 1
1: 0
2: 3
3: 23
4: 148
917669720_917669726 27 Left 917669720 1:177261965-177261987 CCTTCAATTTGGTGACATGGAGG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 917669726 1:177262015-177262037 CAGTACATGAAGAGTACAAAAGG 0: 1
1: 0
2: 2
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917669720 Original CRISPR CCTCCATGTCACCAAATTGA AGG (reversed) Intronic
904650670 1:32003586-32003608 TCTACATATCTCCAAATTGAGGG + Intergenic
906973957 1:50549020-50549042 CCCCCATCTCTCCAAATTAAAGG + Intronic
917669720 1:177261965-177261987 CCTCCATGTCACCAAATTGAAGG - Intronic
919098134 1:193060780-193060802 CCTCCTAGTCTCCAAGTTGAGGG - Intronic
919485768 1:198145495-198145517 CCCCCATGTCACAAAGGTGAAGG + Intergenic
923157585 1:231292197-231292219 GCTTCATGTCACAAAATCGAGGG + Intergenic
923566142 1:235077310-235077332 CCACCACCTCACCAAACTGAAGG + Intergenic
923605052 1:235435651-235435673 CCTCCATCGCACCAAATGCAGGG + Intronic
923882632 1:238120152-238120174 CCTCTCTGTCACCAAGTTGCTGG + Intergenic
1063307567 10:4919403-4919425 CTTTCATGTCCCCACATTGATGG + Intergenic
1069613379 10:69790342-69790364 CCTCCAAGTCACCACAGTTATGG - Intergenic
1072443067 10:95474294-95474316 CCTCCATGCCACCAAAGAAACGG + Intronic
1073362858 10:102914256-102914278 CCTCCATTTAAACAAATGGACGG + Intergenic
1074407388 10:113191122-113191144 CCTCCCTGTTTCCAAATAGAAGG - Intergenic
1076990500 11:271061-271083 CTTCCATGTCACCACCCTGATGG + Intergenic
1078324121 11:10365388-10365410 TCCCCAGGTTACCAAATTGAGGG - Intronic
1078652932 11:13212812-13212834 CCTCCATGTCATGAAATTTAAGG - Intergenic
1079449849 11:20590623-20590645 GCTCCATGTCTCCATTTTGAAGG + Intergenic
1083182171 11:60994035-60994057 CCTCTCTGTCACCAAATCCAAGG - Intronic
1084181034 11:67446030-67446052 CCAGGATGTCAGCAAATTGAGGG + Intergenic
1084242253 11:67829968-67829990 GCTATTTGTCACCAAATTGAAGG + Intergenic
1087621912 11:100552818-100552840 TCTTCATGTCTCCAAATTGAAGG - Intergenic
1090534337 11:127624302-127624324 CCTCCAGGTCACCAAGGAGAGGG - Intergenic
1091042157 11:132291821-132291843 CTTCCATGTGTCCAAATTCATGG - Intronic
1092202914 12:6597958-6597980 CCTCCATCTCTGCAAATTTAGGG + Exonic
1100868560 12:98885681-98885703 CCTTTATTTCACCAAATTGACGG - Intronic
1103099159 12:118157272-118157294 TCTCCATGTCACCAGAGTGATGG + Intronic
1106453808 13:29909515-29909537 CCACCATGTCACCAGATGGCTGG + Intergenic
1108578288 13:51807654-51807676 TCTCCATGTAGCCAAGTTGATGG + Intergenic
1114156839 14:20113389-20113411 ACTTCATGACACCAAATTAAGGG - Intergenic
1118179799 14:63480916-63480938 CCTCCCTGTCACCAAACAAAGGG + Intronic
1121032166 14:90667456-90667478 ACCCCCTCTCACCAAATTGATGG - Intronic
1121513706 14:94534864-94534886 CCTCCATGACACCCTATGGAAGG - Intergenic
1124344360 15:28912225-28912247 CTTACATGTCACAAAATGGATGG - Intronic
1124362290 15:29046503-29046525 CCTCCTTGTCAACAAATACAAGG - Intronic
1125016676 15:34945038-34945060 ACTCCTTTTCACCATATTGAAGG + Intronic
1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG + Intronic
1132421637 15:101674892-101674914 CCTGGATGGTACCAAATTGATGG - Intronic
1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG + Intronic
1138593539 16:58016730-58016752 CCTCCACGTTACCAAATCCAAGG - Intronic
1139258120 16:65562986-65563008 CCTCTTTGTCTCCAAATTGTAGG - Intergenic
1145314329 17:21720309-21720331 CCTCAATTTCAGCAAAATGATGG + Intergenic
1148149844 17:45390131-45390153 CCTCGATGCCATCACATTGAGGG - Intergenic
1149312939 17:55413316-55413338 CCTCAATGTCACTAAATGCAAGG + Intronic
1149324253 17:55513659-55513681 CCTCCATGTAACAATATTTAGGG + Intergenic
1153730888 18:8010648-8010670 CCTCCATCTCACCAAGTCCATGG - Intronic
1160434789 18:78841486-78841508 CCTCCACGTCACCTAGTTGCTGG - Intergenic
1167043917 19:47039186-47039208 CAGCCATGTCCCCAGATTGAGGG + Intronic
932707398 2:74037353-74037375 CTTCCTTGCCACCAAATGGATGG - Intronic
933476600 2:82799448-82799470 GCTCTATGTCACCAAACTGAGGG + Intergenic
933975753 2:87508002-87508024 CCTCCATTTCAGCAAATCAAAGG - Intergenic
936318073 2:111442811-111442833 CCTCCATTTCAGCAAATCAAAGG + Intergenic
937028964 2:118722166-118722188 CCTCCAGGATACCAACTTGAAGG + Intergenic
942867980 2:180699166-180699188 CCCCCAACTCACCACATTGAGGG - Intergenic
943912353 2:193584605-193584627 CCTACATGTCACCCAATGGCAGG - Intergenic
946284692 2:218694137-218694159 CCTCCAAGGCACAAAGTTGATGG - Intronic
946677837 2:222181284-222181306 TCTCTCTGTCACCAAGTTGAAGG - Intergenic
947123290 2:226839675-226839697 CAGCCATGTCACCATATGGATGG + Intronic
1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG + Intronic
1173875899 20:46371397-46371419 CATCCAAGTCACCATAGTGAAGG + Exonic
1177154579 21:17488362-17488384 TCTCCATGTCTCCTAATTGGAGG + Intergenic
1177385322 21:20402653-20402675 CCTCATTGTGACCAAATTGTAGG + Intergenic
1184581199 22:45418901-45418923 CCTCCATGTCGCCCAATCCAAGG + Intronic
951748941 3:26012351-26012373 CCACCCTGTCCCCAAAATGAAGG - Intergenic
954034837 3:47845898-47845920 CCTCCATCTCTCCAGACTGAAGG + Intronic
954041978 3:47895177-47895199 CCACCATGTCAGTAAATTAAGGG - Intronic
955034210 3:55250572-55250594 CCTGCAAGTCACCATGTTGAAGG - Intergenic
961890062 3:130123323-130123345 GCTATGTGTCACCAAATTGAAGG + Intergenic
965316457 3:167197104-167197126 CCTCTTTGTCACCAAATGGAAGG - Intergenic
966732867 3:183164745-183164767 CCTCCTTATCACTAGATTGAGGG + Intergenic
969000534 4:3977307-3977329 GCTACGTGTCACCAAATTGAAGG + Intergenic
969753480 4:9131362-9131384 GCTATGTGTCACCAAATTGAAGG - Intergenic
969813383 4:9667545-9667567 GCTATGTGTCACCAAATTGAAGG - Intergenic
971110535 4:23580365-23580387 CCTCCCTGGCTCCAAAGTGAGGG - Intergenic
986026183 5:3853564-3853586 CCTCCATGTCACCAACATGCTGG + Intergenic
987451057 5:18084561-18084583 ACTCCATGTCACCAAGTAAATGG - Intergenic
993913312 5:93710360-93710382 CCTCCATGTCACCAATCAGTTGG + Intronic
997016012 5:129936564-129936586 TCTCCATGTCACCAGCTTGCTGG + Intronic
1000209190 5:159095568-159095590 GCTCTATGTCACAAAATTCAGGG - Intronic
1001126414 5:169023693-169023715 CCTACATTCCACCATATTGAAGG + Intronic
1004017988 6:11749714-11749736 TCTCCATGTTACCAAATTCTGGG - Intronic
1004286846 6:14329206-14329228 GCTCCTTGTCACCAAAGTGCTGG - Intergenic
1006951082 6:37821051-37821073 CCTCTATGTCTCCAAATATACGG - Intronic
1007204447 6:40137143-40137165 ATTCCATGTCTCCAAATTGGAGG + Intergenic
1009427512 6:63530567-63530589 CCTCCATGTTCACAAATTCAGGG - Intronic
1009969116 6:70607897-70607919 CCTCCAAATATCCAAATTGAAGG + Intergenic
1011861591 6:91764572-91764594 TCTCTATGTCACCATTTTGATGG + Intergenic
1013292106 6:108728645-108728667 CCTCTCTGTCCCCAAATTAAAGG - Intergenic
1014125277 6:117769977-117769999 CCTCCCTGTCTCCAAGATGAAGG - Intergenic
1015159758 6:130139598-130139620 CCCCCATTTTAGCAAATTGATGG + Exonic
1018088362 6:160324788-160324810 CATCGGTGTCACCAAACTGAAGG + Intergenic
1019093687 6:169561970-169561992 CCACCATGTCATCACAATGAAGG + Intronic
1019883707 7:3885316-3885338 CCCCCAAGTTACCAAATTCAAGG - Intronic
1020099531 7:5387332-5387354 CCTCGATGACTTCAAATTGAAGG + Intronic
1023217390 7:37878229-37878251 CCACCATGTTATCAAAATGAAGG - Intronic
1024991105 7:55235159-55235181 CCTCTATGTCTCCAAAGTCACGG - Intronic
1025241932 7:57283906-57283928 CCTCTATTTCCCCAACTTGAAGG - Intergenic
1026166698 7:67916399-67916421 CCTCCCTTTCCCCAACTTGAAGG - Intergenic
1029034029 7:97499690-97499712 CCTCCATGTCGCCAACTCTATGG + Intergenic
1030227893 7:107171985-107172007 CCTGCATATCACAAAATTCAGGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1036852840 8:12216444-12216466 GCTATGTGTCACCAAATTGAAGG + Intergenic
1037606532 8:20442395-20442417 CTTCCATGTTACCAAATCCAGGG - Intergenic
1037637072 8:20709718-20709740 CCTCCATGTTGCCAAATCTACGG - Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038297256 8:26305626-26305648 CCTCCATGTACCTAAAATGAAGG - Intronic
1038709236 8:29925936-29925958 TCTCCATGTCACCATACTGGAGG + Intergenic
1038814223 8:30884595-30884617 CATCTAGGTCACCAAATTTATGG + Intronic
1044448102 8:92302015-92302037 CTCCCATTTCACCAAAATGAAGG - Intergenic
1045323018 8:101096110-101096132 CATCCATTTCACAATATTGAAGG - Intergenic
1045459266 8:102412333-102412355 CCTCCCAGTCCCCAAATGGAGGG + Exonic
1054986773 9:71270738-71270760 CCACCATCTCACCATATTGCTGG - Intronic
1056960442 9:91117920-91117942 CCTCCAAGTCACCAAATACGAGG - Intergenic
1057891694 9:98874636-98874658 CATCCATGTCAAGAAAGTGATGG + Intergenic
1057912335 9:99029621-99029643 CCTCCATAAAACCAAATAGATGG + Intronic
1058190051 9:101902741-101902763 CCTCCACTTAACCAAATTGCTGG + Intergenic
1186860850 X:13670957-13670979 CCTCTACGTCACTAAATTCAGGG + Intronic
1188897084 X:35682456-35682478 CTACTATGTCACCAAATTTAAGG - Intergenic
1194939886 X:99997002-99997024 CCTTCATGCCACCAGATTGAAGG + Intergenic
1196043161 X:111227999-111228021 CCTCCAGTTTACCAAATTGCTGG - Intergenic
1197376409 X:125687261-125687283 CCTACATGTGCCCAAAGTGAGGG + Intergenic
1198278021 X:135114827-135114849 CCTTCATATCAGCAACTTGAGGG - Intergenic
1198655237 X:138906767-138906789 ACTCCATGTCACAGAACTGAAGG - Intronic
1199859100 X:151783716-151783738 CCTACTAGTCACCAACTTGATGG + Intergenic