ID: 917670315

View in Genome Browser
Species Human (GRCh38)
Location 1:177267730-177267752
Sequence CCTCTTAAGCAGTCTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917670315 Original CRISPR CCTCTTAAGCAGTCTGTGGG TGG Intronic
900817897 1:4863915-4863937 CATTTAAAGCAGTATGTGGGGGG - Intergenic
901214484 1:7548296-7548318 CCTCTTCTGTAGACTGTGGGAGG + Intronic
901932098 1:12602397-12602419 CCTTTCTAGAAGTCTGTGGGAGG - Intronic
904372308 1:30057441-30057463 CCGCCACAGCAGTCTGTGGGGGG - Intergenic
915776857 1:158499784-158499806 TCTCTGAAGTACTCTGTGGGTGG + Intergenic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
917965765 1:180177617-180177639 CCTCTTCTGAAGTCTGAGGGTGG + Intronic
921632918 1:217456169-217456191 ACACTTAAGCTGTCTGTGGATGG + Intronic
922788026 1:228293058-228293080 TCTCTGGAGCACTCTGTGGGGGG - Intronic
923648875 1:235853110-235853132 CATCTTGAGAAGTTTGTGGGGGG - Intronic
1063224911 10:4006552-4006574 CCTCTTCAGGAGTCTGAGGCAGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065105644 10:22381200-22381222 CCTCTAAAACAGCCTGTGGGGGG - Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067820026 10:49520288-49520310 CTGCATAATCAGTCTGTGGGTGG + Intronic
1068351071 10:55845921-55845943 CCTCCTAGGCAGTGTGTGGGGGG - Intergenic
1068740791 10:60467422-60467444 CATCTTTAGCAGGATGTGGGAGG + Intronic
1070147435 10:73785431-73785453 CCTCTTATGATGTCTGAGGGTGG + Intergenic
1070336828 10:75463393-75463415 CCTCTCAGACAGTCTGTGGGAGG - Intronic
1071572056 10:86702724-86702746 CCTCTGAAGCATTCTGAAGGGGG - Intronic
1072279243 10:93851092-93851114 ACACTTAAGCCGTCTGTGGGTGG + Intergenic
1074356103 10:112784872-112784894 CCTTTTAAAAAGTCAGTGGGAGG - Intronic
1074676734 10:115859715-115859737 ACCATTAAACAGTCTGTGGGAGG - Intronic
1079487751 11:20953075-20953097 CTTCTTAACCAGTCCATGGGTGG + Intronic
1079925502 11:26487596-26487618 CCACTTAACCAGTCTTTAGGAGG - Intronic
1083603362 11:63962246-63962268 CCTCTTCATCTGCCTGTGGGTGG - Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086517931 11:87635442-87635464 ACTCTCAAGTAGTCTGTGAGTGG + Intergenic
1088571616 11:111228693-111228715 CCTCCTAACCAGTCTGGGTGGGG + Intergenic
1089083995 11:115801364-115801386 CTGCTTAAACAGTCTGTGAGGGG + Intergenic
1090306801 11:125698237-125698259 CCTCTTTAGCAGGGTGTGGTGGG + Intergenic
1092465628 12:8729149-8729171 ACACTTAAGCCGTCTGTGGATGG - Intronic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1094275296 12:28668592-28668614 CCTTTTAAGCTCTCTGGGGGAGG + Intergenic
1097020462 12:56017079-56017101 TCTCTTTAGGAGCCTGTGGGAGG - Intronic
1099934630 12:89110553-89110575 CCTCATAAGAAGTCTGTTTGAGG + Intergenic
1100041765 12:90328282-90328304 CATCTCAAGCAGACTGTCGGGGG - Intergenic
1100384354 12:94091759-94091781 TGTCTTTAGCAGTCTGTGGGAGG - Intergenic
1101119734 12:101566306-101566328 CCTCTTTAGGAGTCTGGGTGCGG + Intergenic
1101735853 12:107462328-107462350 CCTCTAAACCAGTGTTTGGGGGG + Intronic
1102001870 12:109562473-109562495 GCTCTTTTGCAGTCTGAGGGAGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1108213667 13:48162510-48162532 CTTATTAAGCATTCTGTGTGTGG - Intergenic
1111636198 13:90907416-90907438 ACACTTAAGCTGTCTGTGGATGG - Intergenic
1112190451 13:97172188-97172210 CTCCTTAAGCACTCTGTGGCTGG - Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1116159416 14:41249799-41249821 CCTCTGAAACAAACTGTGGGAGG - Intergenic
1117012825 14:51488249-51488271 CTTCTGAAGAAGTCTGGGGGTGG + Intergenic
1117954409 14:61111447-61111469 CCTCTGGAGCAGGCTGGGGGAGG + Intergenic
1119029826 14:71183290-71183312 ACCCTGAAGCATTCTGTGGGAGG - Intergenic
1119768803 14:77207313-77207335 CCTCTTAACACCTCTGTGGGTGG - Intronic
1121845883 14:97171680-97171702 CATTTAAAGCAGTGTGTGGGAGG - Intergenic
1129312008 15:74719391-74719413 GCACTTAAGCAGTCTGTTTGAGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131671642 15:94626137-94626159 CCTCTTAAGAAGCCTCTGGGTGG + Intergenic
1132607268 16:798812-798834 CCACTTCAGCAGCCTGCGGGTGG + Exonic
1135227483 16:20674456-20674478 CCTTTTAAGCATTTTGGGGGTGG - Intronic
1137895334 16:52205781-52205803 CATCTTCAGGAGGCTGTGGGAGG - Intergenic
1138182859 16:54954476-54954498 CCTCTGCAGCAAGCTGTGGGAGG - Intergenic
1140959971 16:79902405-79902427 CCACTGAAGCTGTCTGTGGTAGG - Intergenic
1141155451 16:81593783-81593805 CCTCTTGAGGAGTCTGGGGGAGG + Intronic
1141360595 16:83391935-83391957 CCTGATAAACAGTCTTTGGGTGG - Intronic
1141898881 16:86977318-86977340 GCCCTCAAGCAGTCTGTGGGAGG - Intergenic
1146790642 17:35748707-35748729 CCTCTAATCAAGTCTGTGGGTGG + Intronic
1149324422 17:55515560-55515582 CCTTATAAGCAGGCTGTGTGAGG + Intergenic
1152302768 17:79505116-79505138 CCACTTAAGCAGCTTCTGGGTGG - Intronic
1152770651 17:82166401-82166423 GCTCTTCAGCAGTCTGAGGCAGG + Intronic
1154329862 18:13421097-13421119 CCTCTTCTGCAGTCTCTGCGAGG + Intronic
1156366906 18:36438015-36438037 CCTCTGGAGGAGTGTGTGGGAGG - Intronic
1156941319 18:42770075-42770097 CCTATGAAGCAGTCTCTGGGTGG - Intronic
1157623137 18:49027408-49027430 CCTATTAAGCAGACTCCGGGAGG + Intergenic
1158461931 18:57654063-57654085 CCTCGTATGCAGTCTGTGAGGGG + Exonic
1160838623 19:1136452-1136474 TCTCTAAGGCTGTCTGTGGGCGG + Intronic
1161691122 19:5734926-5734948 CCTCGTGAGAAGTGTGTGGGAGG - Intronic
1202645275 1_KI270706v1_random:133388-133410 ACACTTAAGCCGTCTGTGGATGG + Intergenic
925646000 2:6037499-6037521 CCTCTCAAGCAGCCTATGGTGGG - Intergenic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
930564182 2:52999043-52999065 CCTCTTTCCCAGTCTGTGTGAGG - Intergenic
930587653 2:53287994-53288016 ACTCTTCAACAGTCTGTGTGAGG - Intergenic
931198344 2:60074013-60074035 CCTCTTCAGCACTCTGAGGACGG + Intergenic
938699496 2:133863424-133863446 ACACTTAAGCTGTCTGTGGATGG - Intergenic
939866918 2:147483090-147483112 CCTCATAAGAAGTGTATGGGTGG - Intergenic
940862709 2:158787192-158787214 ACACTTAAGCAGTCTGCGGATGG - Intergenic
943536789 2:189162091-189162113 CCTCTCAGGCAGTATGTGGGAGG + Intronic
944748426 2:202682286-202682308 ACTCTTAAGCCGTCTGCGGATGG + Intronic
948335364 2:237202997-237203019 CATGTTTAGCAGCCTGTGGGGGG + Intergenic
1171895236 20:30752308-30752330 ACACTTAAGCCGTCTGTGGATGG + Intergenic
1172276775 20:33684405-33684427 CCTCTTAATGAGTGGGTGGGAGG - Intronic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1178775784 21:35549048-35549070 CCCATTAAGTAGTTTGTGGGTGG + Intronic
1180356684 22:11849056-11849078 ACACTTAAGCTGTCTGTGGATGG - Intergenic
1180381577 22:12143275-12143297 ACACTTAAGCCGTCTGTGGATGG + Intergenic
1182861941 22:33567940-33567962 CCTATCAGGCAGTGTGTGGGTGG + Intronic
1183737719 22:39653134-39653156 CCTCTTAGCCACTGTGTGGGGGG - Intronic
1184996040 22:48208337-48208359 CCTATAAAGCAGTCCATGGGAGG - Intergenic
949375439 3:3384323-3384345 CCTCTTACCCTGTCTTTGGGTGG - Intergenic
953035628 3:39208162-39208184 CCTGTTAATCTGTCTGTGGTTGG + Intergenic
953699628 3:45185741-45185763 CCACCAAAGCAGCCTGTGGGTGG - Intergenic
955038738 3:55293875-55293897 ACACTTAAGCTGTCTGTGGATGG + Intergenic
955589000 3:60514232-60514254 ACACTTAAGCTGTCTGTGGATGG + Intronic
957414103 3:79878469-79878491 ACACTTAAGCCGTCTGTGGATGG - Intergenic
958023645 3:88026113-88026135 ACACTTAAGCTGTCTGTGGATGG - Intergenic
958100253 3:88999591-88999613 ACACTTAAGCTGTCTGTGGCTGG + Intergenic
964247146 3:154666839-154666861 ACACTTAAGCTGTCTGTGGATGG - Intergenic
964978443 3:162647818-162647840 CCCATTAAGGACTCTGTGGGAGG - Intergenic
966807212 3:183817130-183817152 CCTCTTGAGAAGCCTGTGGAAGG - Exonic
966994076 3:185263196-185263218 CCACTTCAGCAGTCTGAGGCGGG - Intronic
968598533 4:1497923-1497945 ACACTTAAGCTGTCTGTGGATGG - Intergenic
969629019 4:8324543-8324565 CCTCTTTACCAACCTGTGGGTGG + Intergenic
972792642 4:42387635-42387657 CCTCTGAAGAAGTCTGTGGTTGG - Intergenic
973371499 4:49251803-49251825 ACACTTAAGCTGTCTGTGGATGG + Intergenic
973389507 4:49543508-49543530 ACACTTAAGCCGTCTGTGGATGG - Intergenic
981205578 4:142035823-142035845 CCTCTACAGCTGGCTGTGGGTGG - Intronic
981554940 4:145982912-145982934 CCTCTTAAGCACTGGGTGAGGGG - Intergenic
984373676 4:178899720-178899742 ACACTTAAGCCGTCTGTGGAAGG - Intergenic
985606874 5:862533-862555 GCTCTGAAGCAGTTTCTGGGTGG - Intronic
988785779 5:34564454-34564476 TCTCTTAGGGAGTCTGTGGAGGG - Intergenic
989303306 5:39920297-39920319 CCTCTGAGGCAGTATTTGGGAGG + Intergenic
989623259 5:43405486-43405508 CATTTTAAGCAGTGTGTAGGGGG + Intronic
990294432 5:54386217-54386239 GCTCTTAAGCTGGCTGTGCGAGG + Intergenic
991202999 5:64016041-64016063 TCTCTTAGGCAGTCTGCTGGAGG - Intergenic
992226058 5:74620630-74620652 ACACTTAAGCTGTCTGTGGATGG - Intergenic
994936938 5:106266481-106266503 TCACTTAAGCAGTCTTTGGAAGG - Intergenic
999100396 5:149019094-149019116 CCTCCTAAGCAATCTGTGCCAGG + Intronic
1000664557 5:163979221-163979243 ACACTTAAGCAGTCTGTGGATGG - Intergenic
1001969542 5:175943597-175943619 ACACTTAAGCTGTCTGTGGATGG - Intronic
1002247893 5:177900156-177900178 ACACTTAAGCTGTCTGTGGATGG + Intergenic
1002762683 6:214198-214220 ACACTTAAGCCGTCTGTGGATGG + Intergenic
1003487972 6:6595872-6595894 CCTATTCAGCAGTGTGTGGAGGG + Intronic
1004141770 6:13024698-13024720 ACTATTAAGCAGCCTGTGGTCGG + Intronic
1006894724 6:37460256-37460278 CCTCTTAAGCAGTAGCTGTGTGG + Intronic
1006988346 6:38192251-38192273 CCTCTCAAGCCCTCTGTGGTTGG + Intronic
1007154718 6:39731329-39731351 CCTCCCTATCAGTCTGTGGGTGG + Intergenic
1007451860 6:41946187-41946209 CCTCACAACCACTCTGTGGGGGG - Intronic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1011701169 6:89956334-89956356 CCTAGGAAGCAGTCTGTGGGAGG - Intronic
1013488685 6:110622683-110622705 GCTCTTGAGCAGTCTTTAGGTGG + Intronic
1014014882 6:116518649-116518671 CCTCTTTTGCAGTGTGTGAGAGG + Exonic
1014652053 6:124051961-124051983 CCTCCCAGGCAGTCTGTAGGAGG - Intronic
1015465106 6:133540283-133540305 CCTGTTAAGCAGAATGTTGGAGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1020431146 7:8117340-8117362 CCTCTTAACCATTCTGGGGCAGG - Intronic
1024226930 7:47332496-47332518 CTTCTGAAGCAGCCTGTGGCTGG - Intronic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029008004 7:97230459-97230481 ACACTTAAGCTGTCTGTGGATGG + Intergenic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1029788323 7:102816123-102816145 TCACTAAAGCTGTCTGTGGGTGG - Intronic
1031627481 7:124007475-124007497 AGTCTTCAGCAGTCTGCGGGAGG + Intergenic
1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG + Intergenic
1032797689 7:135290754-135290776 ACACTTAAGCTGTCTGTGGATGG + Intergenic
1033432486 7:141301767-141301789 GCTCACAAGCAGTCTGTTGGTGG - Intronic
1034266280 7:149782631-149782653 CCTCATGATCAGTGTGTGGGAGG - Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1040908262 8:52491341-52491363 ACACTTAAGCTGTCTGTGGATGG - Intergenic
1042984406 8:74566880-74566902 ACACTTAAGCTGTCTGTGGATGG + Intergenic
1046619270 8:116511218-116511240 TCCCTAAAGCAGTCTGTGGATGG - Intergenic
1048731085 8:137441818-137441840 ACACTTAAGCAGTCCGTGGATGG - Intergenic
1050082926 9:1934225-1934247 CATTTAAAGCAGTGTGTGGGGGG - Intergenic
1054353414 9:64040459-64040481 ACACTTAAGCCGTCTGTGGATGG - Intergenic
1055240758 9:74183185-74183207 ACACTTAAGCTGTCTGTGGATGG - Intergenic
1055869305 9:80855182-80855204 ACACTTAAGCTGTCTGTGGATGG - Intergenic
1055979067 9:81983733-81983755 CATTTTAAGCAGCCTGTGGGAGG - Intergenic
1056009452 9:82311761-82311783 TCTCTTAAGCAGTCTGTAGAGGG - Intergenic
1058506448 9:105670845-105670867 GTTTTTAAGCAGTATGTGGGAGG + Intergenic
1058678969 9:107425178-107425200 CCTCTGAACCAGACTCTGGGGGG - Intergenic
1058964255 9:110021952-110021974 CCACTAATGCAGTCTGGGGGTGG + Intronic
1060194938 9:121617471-121617493 CATCTCAAGCGTTCTGTGGGAGG + Intronic
1203695938 Un_GL000214v1:96871-96893 ACACTTAAGCCGTCTGTGGATGG + Intergenic
1203741746 Un_GL000218v1:9569-9591 ACACTTAAGCAGTCTGTGGATGG - Intergenic
1203640335 Un_KI270751v1:7192-7214 ACACTTAAGCCGTCTGTGGATGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186946408 X:14573247-14573269 CCTCTTCAGAAGTCCGTGTGGGG - Intronic
1188311183 X:28618786-28618808 CCACTTAAATATTCTGTGGGTGG + Intronic
1188888534 X:35581510-35581532 CCACTTAAGCGGTCTCTAGGAGG - Intergenic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190971758 X:55356709-55356731 CCTCTTAGGCAGTCTCTAGAGGG - Intergenic
1192288824 X:69769421-69769443 CCTGTTAAGCAGTATGTTGTTGG + Intronic
1199998926 X:153046534-153046556 CCACTAAAGCAGTGTGTGGCTGG + Intergenic