ID: 917670647

View in Genome Browser
Species Human (GRCh38)
Location 1:177270480-177270502
Sequence ATGAACAAGATGATGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917670647 Original CRISPR ATGAACAAGATGATGGTGGG GGG Intronic
900724651 1:4208031-4208053 AGGGACAAGAGGCTGGTGGGTGG + Intergenic
903416327 1:23185735-23185757 ATGAACAAGATGATGGCTGGGGG + Intergenic
908430241 1:64049783-64049805 TTGAACCAGCGGATGGTGGGAGG - Exonic
909468893 1:76004171-76004193 TTGATGTAGATGATGGTGGGTGG - Intergenic
912553559 1:110499999-110500021 ATTTATAAGAAGATGGTGGGAGG - Intergenic
913510704 1:119559031-119559053 ATGACCAACATGATGGTGGTAGG + Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914846631 1:151287145-151287167 AGGAAGAAGATGATGATGAGGGG + Exonic
916203170 1:162290730-162290752 ATCAACAAGCTAATTGTGGGAGG - Intronic
916506604 1:165433795-165433817 ATGGTCCAGTTGATGGTGGGAGG - Intronic
916843052 1:168620073-168620095 AGGAAAAAGATGATGGTGGCTGG + Intergenic
917273237 1:173301749-173301771 ATGAACAAGATAGTTGTAGGTGG - Intergenic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
918182717 1:182098444-182098466 ATGAACATGATGATGGTAATGGG + Intergenic
918633931 1:186752203-186752225 GTGAACAAAATGATGATGGATGG - Intergenic
922189615 1:223306409-223306431 ATCAACAGGAAGATGGTGGCAGG + Intronic
1065265169 10:23967308-23967330 ATGAATAAGAAGATGGTATGAGG + Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065662063 10:28015123-28015145 ATGCAAAAAATGTTGGTGGGGGG - Intergenic
1066099888 10:32108300-32108322 ATGAGCAAAATGCAGGTGGGTGG + Intergenic
1069618660 10:69822627-69822649 ATGAACAAATGAATGGTGGGTGG - Intronic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1072789103 10:98304526-98304548 CTGAAAAAGATGATGGGGTGGGG + Intergenic
1073727035 10:106244789-106244811 ATGCACAAAATGATAGTTGGGGG + Intergenic
1074556439 10:114495409-114495431 ATGATAATGATGATGGTGAGTGG + Intronic
1074697182 10:116059984-116060006 AAGAACAAGGTGGTGGAGGGAGG + Intronic
1075847605 10:125557552-125557574 ATGAAAAAGATGATGTTGAAGGG - Intergenic
1076333104 10:129686017-129686039 ATGAACTAGATGAAGGATGGCGG - Intronic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1078450880 11:11439876-11439898 AAGAACAGGATGATGGAGGCAGG + Intronic
1079038929 11:17043977-17043999 AAGAACAATATCATGGCGGGGGG + Intergenic
1079927424 11:26511857-26511879 AAGATCAAGATGGTGGTGGGAGG + Intronic
1082196086 11:49307947-49307969 ATGACCAAAATGATGGTGACTGG - Intergenic
1082616520 11:55367773-55367795 ATGAAAAGGATAATTGTGGGAGG + Intergenic
1082626297 11:55491011-55491033 ATGAAAAGGATAATTGTGGGAGG + Intergenic
1082768898 11:57190432-57190454 TTGGACAAGATGATGGCGGTGGG - Exonic
1083866821 11:65459662-65459684 ATGATAAAGGAGATGGTGGGGGG - Intergenic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1085574555 11:77590302-77590324 ATGATGCAGATGATGCTGGGGGG + Exonic
1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG + Intronic
1086579181 11:88377184-88377206 GTAAACAAGATGATTGAGGGTGG - Intergenic
1086688348 11:89759147-89759169 ATGCTAATGATGATGGTGGGTGG + Intergenic
1086717512 11:90080798-90080820 ATGCTAATGATGATGGTGGGTGG - Intergenic
1089157346 11:116412698-116412720 GTAAACAAGACGGTGGTGGGAGG - Intergenic
1090379809 11:126318526-126318548 AAGAACGAGAGGTTGGTGGGAGG - Intronic
1090583367 11:128184095-128184117 AGCAACAAGAAGAGGGTGGGGGG - Intergenic
1090746045 11:129705596-129705618 AAGAACAATATGAGAGTGGGAGG - Intergenic
1091405276 12:204784-204806 AAGAACAGGATGGTGGAGGGCGG - Intronic
1091544316 12:1490921-1490943 GTTAACAAGAAGATGGTGTGAGG + Exonic
1092039013 12:5367076-5367098 ATGAAGAGGCTGATGCTGGGAGG + Intergenic
1093045942 12:14444905-14444927 ATATACAAGATGATTTTGGGGGG + Intronic
1094140640 12:27178303-27178325 ATGAACAAAAAGAAGGTTGGAGG - Intergenic
1094207730 12:27858440-27858462 AAGAAAAAGATGATGATGGAGGG + Intergenic
1095697093 12:45155315-45155337 ACCAACAATATCATGGTGGGTGG - Intergenic
1096463600 12:51836360-51836382 ATGAGGATGAGGATGGTGGGCGG - Intergenic
1097279530 12:57836093-57836115 ATCCACGTGATGATGGTGGGAGG - Intronic
1097370649 12:58775793-58775815 ATGAACAAGAAGATTTTGAGGGG - Intronic
1099180997 12:79472694-79472716 TTGAACAATATCATGGGGGGCGG - Intergenic
1101421981 12:104557704-104557726 AGGAGCAAGAGCATGGTGGGAGG + Intronic
1103770122 12:123315929-123315951 AAGAACATGAAGATGGAGGGAGG + Intronic
1104030068 12:125058652-125058674 ATGCAAAAGATGATGGTGGCTGG - Intergenic
1104145121 12:126025925-126025947 ATGCACAAGATGAGGGTAGGGGG - Intergenic
1105600202 13:21879804-21879826 ATAAACAAGAGGGTGGTGGATGG - Intergenic
1106399937 13:29419856-29419878 ATGAACATAATGATGTTGGCTGG - Intronic
1106419060 13:29570469-29570491 AGGAACAAGATGGAGGTAGGGGG - Intronic
1107932920 13:45321185-45321207 AAGAACAAAATAATGGGGGGGGG + Intergenic
1108355188 13:49623769-49623791 ATGTACAAGATGGGGCTGGGTGG - Intergenic
1109131271 13:58589225-58589247 ATGAGCAAACTGCTGGTGGGTGG - Intergenic
1109354126 13:61218480-61218502 ATGAACAAGATCATAGAAGGGGG - Intergenic
1109355374 13:61226605-61226627 AGGAACAATATCATGGCGGGGGG + Intergenic
1110691501 13:78434405-78434427 ATATACAGGATGATGGTGGCCGG - Intergenic
1111810794 13:93093694-93093716 AGGAACAAAATAATGGGGGGGGG - Intergenic
1112708151 13:102095926-102095948 ATGAACAACATGAAGGTTTGGGG - Intronic
1112743674 13:102503722-102503744 AAAAACAAGATGAAGTTGGGAGG - Intergenic
1114840894 14:26260916-26260938 ACTTCCAAGATGATGGTGGGCGG - Intergenic
1115401104 14:32961599-32961621 ATGATCATGATGATGATGGAAGG - Intronic
1115455194 14:33593912-33593934 ATGCACAGGATGCTGGTGGTAGG - Intronic
1116519889 14:45834648-45834670 ATGAACAAGATCATAGTGGGAGG + Intergenic
1116525543 14:45899864-45899886 ATGGACAAAATGAAGGTGGGAGG + Intergenic
1117630174 14:57683011-57683033 ATGAACTCAATCATGGTGGGAGG + Intronic
1118813963 14:69295914-69295936 ATGAACAAAACGGTGGTTGGAGG - Intronic
1120921583 14:89760559-89760581 ATTAACTGGATGTTGGTGGGAGG + Intergenic
1121822905 14:96985845-96985867 TTGACCCAGATGATGGTGAGAGG + Intergenic
1122910292 14:104824519-104824541 ATGGACAGTAGGATGGTGGGTGG + Intergenic
1124132175 15:27000634-27000656 AGGAGCAAGGTGGTGGTGGGGGG - Intronic
1124956531 15:34363990-34364012 GTGAATAAAATGATAGTGGGTGG - Intronic
1126986842 15:54321348-54321370 TTGAAAAAGATCTTGGTGGGTGG - Intronic
1128250649 15:66161689-66161711 ATTAAGAAGTTGGTGGTGGGTGG - Intronic
1129184289 15:73896503-73896525 AAGATGAAGATGATGGTGGGGGG + Intergenic
1129769236 15:78193088-78193110 AGGAACAGGGTGATGGGGGGTGG - Intronic
1130045739 15:80443305-80443327 AAGAACAAGTTGATGATGGCAGG + Intronic
1131875599 15:96802906-96802928 ATGCACAAAGTGGTGGTGGGGGG + Intergenic
1131927748 15:97404543-97404565 AGGAACTAGATGGTAGTGGGGGG - Intergenic
1133991397 16:10710290-10710312 ATGAACAATATCACGGGGGGGGG + Intergenic
1134690888 16:16190521-16190543 AGGTACAGGATGATGGTGGTTGG - Intronic
1135027190 16:19007441-19007463 ATGAGCAAGAACCTGGTGGGCGG - Intronic
1138748212 16:59388433-59388455 CTCAAAAAGATGGTGGTGGGGGG + Intergenic
1140271157 16:73467457-73467479 ATGAACAAGATGTAGGTAGCAGG + Intergenic
1141236679 16:82224763-82224785 ATGAACAAAGTGATGGAGGAAGG - Intergenic
1141429560 16:83964700-83964722 ATGAGGAAGATGTTGGTGGCAGG - Intronic
1141854932 16:86674278-86674300 ATGAACAAATGAATGGTGGGAGG - Intergenic
1144152732 17:12465807-12465829 AAGAACAAGCTGATGGTAGAAGG - Intergenic
1144215592 17:13052371-13052393 ATGCCCAAGATGATGGTGTTTGG + Intergenic
1146089441 17:29861550-29861572 AAGAAGAAGATTATGGTGGTGGG - Intronic
1147985745 17:44307043-44307065 AAGAGCAAGATGATGGAGGAGGG + Intergenic
1149538144 17:57448409-57448431 ATGAACAGGAAGATGGTGTGTGG + Intronic
1151364582 17:73608883-73608905 AGGACAAAGATGATGGTGGCTGG + Intronic
1151661104 17:75518634-75518656 GTGAACAAAATGATGGCAGGTGG - Intronic
1152005158 17:77675959-77675981 AAGAAGAAGATGTGGGTGGGTGG - Intergenic
1152030963 17:77842743-77842765 AGGAGAAAGCTGATGGTGGGAGG - Intergenic
1152278081 17:79369616-79369638 CTGACCAAGATGGTGGTGGCAGG - Intronic
1152788610 17:82265688-82265710 ATCTACAAGATGATGCAGGGAGG - Exonic
1203183902 17_KI270729v1_random:93438-93460 AGGAAGAAAATGAGGGTGGGAGG + Intergenic
1153421390 18:4910011-4910033 ATGAAAAAAATGATAGTTGGAGG + Intergenic
1154037726 18:10821672-10821694 ATGAAAAAGGTGGTGGTGGGTGG - Intronic
1155063034 18:22245552-22245574 ATAAACAAGGTGATGGAGGAAGG - Intergenic
1155074355 18:22341874-22341896 ATGAGCCAGATGAGGGTGGGAGG + Intergenic
1155239905 18:23855154-23855176 ATTAATAAGATGCTGGTGGTAGG - Intronic
1155274577 18:24173844-24173866 ATGAACAAAGTGTTTGTGGGTGG - Intronic
1156017227 18:32560317-32560339 ATGAACATGATGACTGAGGGAGG + Intergenic
1156748211 18:40418298-40418320 TTGAACAACTTGATGGTAGGTGG - Intergenic
1157671113 18:49529518-49529540 TTGAAGAAGCTGGTGGTGGGGGG - Intergenic
1158285602 18:55878137-55878159 ATGACCAAGATGATGTAGGTAGG + Intergenic
1158731284 18:60025802-60025824 ATCAACAAAAAAATGGTGGGAGG - Intergenic
1160825422 19:1078037-1078059 AAGAACAAGGTGAGGGCGGGTGG + Exonic
1162394575 19:10409376-10409398 ATGAAGAAGACGATGTTGGAGGG - Intronic
1163347629 19:16753810-16753832 ATGATAGAGATGATGGAGGGAGG - Intronic
1164441476 19:28283340-28283362 GTGGGAAAGATGATGGTGGGGGG - Intergenic
1165644463 19:37422755-37422777 ATGAAGAATATTATGGTGCGGGG + Intronic
1166761061 19:45224701-45224723 AGGAACTGGAGGATGGTGGGGGG + Intronic
1167276521 19:48543445-48543467 ATGAGCAAGATGAGGGTGGGAGG + Intergenic
1202644958 1_KI270706v1_random:131219-131241 ATGAACAATATCATGGGGAGGGG - Intergenic
925671369 2:6312998-6313020 ATGAGCAAGGAGATGGTGTGGGG - Intergenic
926258730 2:11236496-11236518 ATGAACAAGGTGATGGGGAAGGG - Intronic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
929481781 2:42315092-42315114 ATGGACAATATGAAGGTGTGAGG - Intronic
930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG + Intronic
930880665 2:56266582-56266604 AGGAAGAAGATTATGGGGGGGGG - Intronic
932220241 2:69993566-69993588 ATGAATAAGATGCTGTTGAGTGG - Intergenic
933737210 2:85504717-85504739 AGGAAAAAGCAGATGGTGGGGGG - Intergenic
934758476 2:96840441-96840463 GTGAACAAGCTGCTGGTGGCAGG - Exonic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
937449552 2:121990789-121990811 ATGAACCAGATGTTGGAGGTGGG + Intergenic
939440614 2:142244886-142244908 ATGAACAGGGTAGTGGTGGGGGG - Intergenic
941947795 2:171119354-171119376 GAGAACAAGAAGGTGGTGGGGGG - Intronic
942585367 2:177469974-177469996 ATGAACAAGATGAAGTTGATAGG + Intronic
945026276 2:205622711-205622733 TTGAACCGCATGATGGTGGGAGG + Intergenic
947382928 2:229562951-229562973 ATGATGATGATGATGGTGGTGGG - Intronic
947383008 2:229563435-229563457 ATGAAGATGATGATGGTGATGGG - Intronic
947603164 2:231467179-231467201 AAGAACTAGATGGTGGTGAGAGG + Intronic
948071093 2:235126774-235126796 TTGCAGAAGACGATGGTGGGTGG + Intergenic
1170835341 20:19878979-19879001 CTGAACAAGAGGATGGGGTGAGG + Intergenic
1171197647 20:23212846-23212868 AGGAACAAAAAGATGGTGGGTGG - Intergenic
1172307314 20:33889676-33889698 ACCACCAAGATGGTGGTGGGGGG - Intergenic
1172566053 20:35931366-35931388 ATCACCAAGAAGCTGGTGGGTGG - Exonic
1173021173 20:39269175-39269197 ATGCTCAAAAGGATGGTGGGAGG + Intergenic
1173228533 20:41176351-41176373 ATACACAAGAAGGTGGTGGGTGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174645681 20:52083672-52083694 ATGAAACAGATGCTGGTGTGAGG + Intronic
1174706353 20:52660274-52660296 AAGAACAAAATGAAGGAGGGTGG + Intergenic
1174830792 20:53810547-53810569 GTGAAGGAGATGAGGGTGGGAGG + Intergenic
1176007598 20:62874993-62875015 ATGAAGAAAATGGGGGTGGGGGG - Intergenic
1176606921 21:8841448-8841470 ATGAACAATATCATGGGGAGGGG + Intergenic
1176696912 21:9989314-9989336 CAGAGAAAGATGATGGTGGGGGG - Intergenic
1177735522 21:25084222-25084244 ATGAAAAAGATAATGGGGTGGGG - Intergenic
1178047546 21:28712197-28712219 ATCAACCAGATCATGGTGGTGGG - Intergenic
1179671835 21:42954747-42954769 AAGAACAATATCGTGGTGGGGGG - Intergenic
1180357001 22:11851225-11851247 ATGAACAATATCATGGGGAGGGG + Intergenic
1180381261 22:12141106-12141128 ATGAACAATATCATGGGGAGGGG - Intergenic
1181054140 22:20252151-20252173 ATGAAGACGATGATGGTGACAGG - Intronic
1182012494 22:27012288-27012310 AGGATGAAGATGATGGTGGGTGG + Intergenic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
1183861526 22:40673743-40673765 ATGACCAACATGTTGGTGGTGGG + Intergenic
1184896565 22:47410666-47410688 AAGAACAAGATGAGGCTGGATGG + Intergenic
1185181378 22:49365455-49365477 AGGAGCAGGAGGATGGTGGGAGG - Intergenic
951185971 3:19713453-19713475 AGGAACAGGTTTATGGTGGGTGG + Intergenic
951336296 3:21426302-21426324 ATGACCAAGAAGATGAGGGGTGG + Intronic
954001970 3:47565036-47565058 ATGAAGGAGTTGAGGGTGGGAGG - Intronic
954927012 3:54244874-54244896 ATGAACAAGAGGATTTTAGGAGG - Intronic
955073920 3:55594929-55594951 ATGAGGATGATTATGGTGGGGGG - Intronic
955095526 3:55793851-55793873 ATTTAAAAGATGATGGTGAGTGG + Intronic
955751440 3:62188791-62188813 ATAAATAAGAACATGGTGGGAGG + Intronic
956443665 3:69304792-69304814 AAGAACATGCTGATGGTGGTGGG + Intronic
958045152 3:88275294-88275316 ATGAACAAGATTATGGAGAAAGG + Intergenic
958089602 3:88859201-88859223 ATGTGAAAAATGATGGTGGGTGG - Intergenic
958733893 3:97988502-97988524 ATGAACATGATGGTACTGGGTGG + Intronic
958970516 3:100605710-100605732 ATCAATAGGATGAGGGTGGGGGG - Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959791580 3:110368092-110368114 AAGAAAAAGATGATGGAGGTGGG - Intergenic
960430150 3:117559284-117559306 ATGAATAAGATGGTGGAAGGGGG + Intergenic
964322639 3:155514148-155514170 ATGAAGAAGATGTTGGTAAGCGG - Intronic
964598723 3:158470484-158470506 TGTTACAAGATGATGGTGGGGGG + Intronic
964850209 3:161087961-161087983 ATGAACAACATGAGGAAGGGTGG + Intronic
964990212 3:162801580-162801602 ATGCACAAGATGATGGTATTAGG + Intergenic
966222281 3:177562764-177562786 ATGTAGAAGATGAGGGAGGGGGG + Intergenic
967842120 3:194014305-194014327 ATGAACAAGAACATGGTGAGGGG + Intergenic
968378948 4:71988-72010 ATGAGCAGGATGGGGGTGGGAGG + Intronic
971505777 4:27365225-27365247 ATGAAGACAATGAAGGTGGGGGG - Intergenic
971837887 4:31792468-31792490 ATGTACAAGAGGATTTTGGGTGG + Intergenic
972631854 4:40848831-40848853 ATGATCAGGATGATGAGGGGAGG - Intronic
972860991 4:43169119-43169141 ATGACCAAGTTCCTGGTGGGAGG + Intergenic
976148369 4:82066756-82066778 ACTAGTAAGATGATGGTGGGTGG + Intergenic
977055243 4:92183010-92183032 TTGAACATGATGATGGGCGGAGG - Intergenic
978645565 4:110926989-110927011 ATCAAACAGATGTTGGTGGGAGG + Intergenic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
978883772 4:113741781-113741803 AAGTACATGATGATGTTGGGAGG - Intronic
979253668 4:118590411-118590433 AGGAGCAAGAGGATGGGGGGAGG - Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
981038128 4:140193448-140193470 ATGAATAATAAGATAGTGGGTGG + Intergenic
981736823 4:147962124-147962146 AGGAAGGAGATGATGGTGGAGGG - Intronic
982105770 4:152010846-152010868 AGGAGGAAGATGTTGGTGGGAGG - Intergenic
983226054 4:165087226-165087248 ATAAACAAGATCATGTTGGCAGG + Intronic
983462465 4:168045533-168045555 AGGCACAAGGGGATGGTGGGTGG - Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
984870347 4:184319495-184319517 ATAAACGAAATGATGGTGGGAGG + Intergenic
985091650 4:186369203-186369225 ATGAAGGTGATGATGGTGGGGGG + Intergenic
988610578 5:32720532-32720554 GGGAACCAGATGATGGAGGGTGG + Intronic
990342369 5:54836093-54836115 ATGAACAGCATTTTGGTGGGTGG - Intergenic
990377107 5:55181947-55181969 ATGAACAAGATGAACAAGGGAGG - Intergenic
990653907 5:57933611-57933633 ATGAGCAAGCTCATTGTGGGAGG + Intergenic
992925136 5:81575523-81575545 AAAAACAAGCTAATGGTGGGAGG + Intronic
993103160 5:83566569-83566591 AAAAAAAAGATGATGGTGGGTGG - Intronic
993128793 5:83870049-83870071 AAAAACAAGATGGAGGTGGGGGG - Intergenic
993193926 5:84715871-84715893 ATGAACAAGATGAGGCAGGAAGG - Intergenic
996912614 5:128672320-128672342 AAGAAAAAAGTGATGGTGGGTGG + Intronic
998383823 5:141744522-141744544 ATAAACAAGATAATTGTGGCAGG - Intergenic
999370508 5:151052318-151052340 CTGAGCTAGAGGATGGTGGGGGG + Intronic
999370612 5:151052816-151052838 GTGAACAAGAGGATGGTTAGGGG - Intronic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1001285667 5:170421680-170421702 ATGAAGATGATGGTGTTGGGAGG - Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007813603 6:44504089-44504111 ATGCAGAAGAATATGGTGGGTGG + Intergenic
1009365994 6:62858289-62858311 AGGAACAATATCATGGGGGGGGG - Intergenic
1013664647 6:112335178-112335200 ATAAACTAGATGATGAGGGGAGG + Intergenic
1013851155 6:114517741-114517763 AAGAAGAAGATGATGATGAGAGG - Intergenic
1015891047 6:137970012-137970034 AAGAAGAAGATGATGGATGGAGG + Intergenic
1018377518 6:163227266-163227288 AGGAACAAGAGGGAGGTGGGAGG + Intronic
1019866027 7:3711421-3711443 ATAAACAAGATGATGATAGATGG + Intronic
1023534092 7:41189839-41189861 ATGCAAAAGATGGTGGTGTGGGG - Intergenic
1025321644 7:58100513-58100535 AGGAAGAAAATGAGGGTGGGAGG + Intergenic
1025565867 7:62433259-62433281 AGGAAGAAAATGAGGGTGGGAGG + Intergenic
1027877315 7:83787402-83787424 ATGAAGAGGATGGTGGTGGCTGG + Intergenic
1029301314 7:99584059-99584081 AGGAACAATATCACGGTGGGGGG + Intronic
1030202049 7:106915608-106915630 ATGATGATGATGATGGTGGAAGG + Intergenic
1030307639 7:108035197-108035219 AAGAAAAAGATAATGGTGGCAGG - Intronic
1031153663 7:118083972-118083994 ATGAAAAAGGTCAGGGTGGGTGG + Intergenic
1034272755 7:149811312-149811334 AGGATCAAGGTGTTGGTGGGTGG + Intergenic
1034418370 7:150976837-150976859 AGGAACAAGATGATCCTGAGGGG - Intronic
1034829060 7:154293499-154293521 ATGAAGGAGTTGATGGGGGGAGG - Intronic
1035236755 7:157502251-157502273 ATGAAAAACATGATCATGGGAGG + Intergenic
1035342696 7:158174326-158174348 ATGGTGAAGATGATGGTGGTGGG - Intronic
1035861071 8:3028182-3028204 ATCGACAAGATGATGTTGGCGGG + Intronic
1035944728 8:3949590-3949612 TTGAAGAACATGAGGGTGGGTGG + Intronic
1036475234 8:9087202-9087224 AAAAATAAGATGAAGGTGGGGGG - Intronic
1038058427 8:23884806-23884828 ATGAAAAAAATATTGGTGGGTGG + Intergenic
1038576971 8:28713055-28713077 ATAAACAGGATGAGGGTGGCGGG - Intronic
1039330238 8:36529870-36529892 ATGAACATAATGAAGGTGGTTGG + Intergenic
1039545571 8:38408532-38408554 AAAAACAACATGATGGGGGGTGG - Exonic
1041292135 8:56318099-56318121 ATCCAAATGATGATGGTGGGAGG + Intronic
1041557673 8:59176082-59176104 AAGAGAAAGATGATGGTGGGAGG + Intergenic
1042090690 8:65155917-65155939 ATTAAAATGATGATGGTGGGAGG + Intergenic
1042823071 8:72952815-72952837 ACAAAAAAGATGAAGGTGGGAGG + Intergenic
1045924452 8:107569168-107569190 AGGAACAATATCACGGTGGGGGG - Intergenic
1045926038 8:107579594-107579616 AGGAACAATATCATGGCGGGGGG - Intergenic
1046110234 8:109714000-109714022 ATGTGCAAGATGATTTTGGGTGG - Intergenic
1046666988 8:117015094-117015116 AAGGACAAGATGTTGGTGAGGGG + Intronic
1048007153 8:130428661-130428683 ATGGTGATGATGATGGTGGGGGG - Intronic
1048056417 8:130870332-130870354 ATGTTCATGATGATGATGGGTGG - Intronic
1049471812 8:142778058-142778080 ATGAACATTATGATGGTGAGAGG - Exonic
1049660613 8:143818206-143818228 ATGAACTCGGTGATGCTGGGGGG - Exonic
1050406225 9:5311251-5311273 ATGTACAAGATGAGAGTGGGGGG + Intergenic
1051157912 9:14171308-14171330 ATGAACAAGAGGTTGTAGGGTGG - Intronic
1053633895 9:39975151-39975173 CAGAGAAAGATGATGGTGGGGGG - Intergenic
1053771851 9:41488353-41488375 CAGAGAAAGATGATGGTGGGGGG + Intergenic
1054209992 9:62275546-62275568 CAGAGAAAGATGATGGTGGGGGG + Intergenic
1054315001 9:63573408-63573430 CAGAGAAAGATGATGGTGGGGGG - Intergenic
1055312564 9:74998200-74998222 ATGAACAAGGTGATTGGGGATGG - Intronic
1055450672 9:76428586-76428608 AGGATGAAGATGGTGGTGGGAGG - Intronic
1057939999 9:99273590-99273612 AGGAACATGCTGGTGGTGGGTGG - Intergenic
1058044472 9:100341610-100341632 AAGTAAAAGATGATGGTGGCCGG - Intronic
1058190422 9:101907866-101907888 AAGTACAAGATGAGTGTGGGAGG + Intergenic
1058345085 9:103951404-103951426 ATTAACAATTTGATGGTGAGAGG - Intergenic
1058518212 9:105796182-105796204 AGGAACAATATCATGGGGGGTGG + Intergenic
1058804703 9:108579412-108579434 ATGAAGCAGATGGTGGTGGAAGG + Intergenic
1058935295 9:109764304-109764326 ATGTACAAGATGGAGGGGGGTGG - Intronic
1059385659 9:113962321-113962343 AGGGAAAAGATGATGGTGGCAGG - Intronic
1060371131 9:123072785-123072807 TGGAACAAGATGATGGAGGCGGG - Intronic
1060495799 9:124117912-124117934 ATGCACTAGATGGGGGTGGGGGG + Intergenic
1061244901 9:129396520-129396542 ATGGATAGGATGATGGAGGGAGG + Intergenic
1061647472 9:132016814-132016836 ATGATCAAAATGATGCCGGGTGG - Intronic
1062409957 9:136418582-136418604 TTGAACATGATGATGGGCGGAGG + Exonic
1203779903 EBV:95551-95573 ATGAAGGGGATGAGGGTGGGGGG + Intergenic
1203695604 Un_GL000214v1:94577-94599 ATGAACAATATCATGGGGAGGGG - Intergenic
1203742059 Un_GL000218v1:11738-11760 ATGAACAATATCATGGGGAGGGG + Intergenic
1203702257 Un_KI270742v1:6328-6350 ATGAACAATATCATGGGGAGGGG + Intergenic
1203640669 Un_KI270751v1:9486-9508 ATGAACAATATCATGGGGAGGGG + Intergenic
1186304217 X:8237632-8237654 ATGAAATACATGATGGTGGGAGG - Intergenic
1187195587 X:17080429-17080451 AAGAACAAGGTGGTGGTGTGGGG - Intronic
1187241693 X:17519811-17519833 ATGACGATGATGATGATGGGAGG - Intronic
1188992376 X:36837805-36837827 ATGAACAAGTTGAGGAAGGGTGG - Intergenic
1190039394 X:47057545-47057567 ATGAACATTATGGTGGTGGGAGG - Intronic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1192530733 X:71882074-71882096 ATGAAGAAGAACAAGGTGGGAGG + Intergenic
1193926375 X:87490735-87490757 ATGATGATGATGATGGAGGGAGG + Intergenic
1195020614 X:100823414-100823436 ATGAAACAAATGAAGGTGGGAGG + Exonic
1196218760 X:113087544-113087566 ATGAAGAAGATCATGGCGGATGG + Intergenic
1198414928 X:136410354-136410376 CTGAACATGGTGCTGGTGGGAGG + Intronic
1199509868 X:148609914-148609936 AAGAACAAGATGGATGTGGGAGG - Intronic
1199750701 X:150814884-150814906 ATGATCAAGATGATGGCCGCAGG - Exonic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1200034947 X:153321014-153321036 ATGTTACAGATGATGGTGGGAGG - Intergenic
1200036249 X:153333834-153333856 ATCTTCAAGATGGTGGTGGGGGG - Intergenic
1200204158 X:154303839-154303861 ATGAGCAAGAAGATGGTGGGGGG - Intronic
1200807278 Y:7445777-7445799 TTCAACATGATGATGGTGGAAGG - Intergenic
1201155590 Y:11129214-11129236 ATGAACAATATCATGGGGAGGGG + Intergenic