ID: 917670678

View in Genome Browser
Species Human (GRCh38)
Location 1:177270637-177270659
Sequence GCTTCCTTCTTTCCTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917670671_917670678 25 Left 917670671 1:177270589-177270611 CCTGTCCTCCTCTTTGGGTCACA 0: 1
1: 0
2: 3
3: 7
4: 200
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271
917670676_917670678 -6 Left 917670676 1:177270620-177270642 CCACTTAAGGCTTGTTAGCTTCC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271
917670673_917670678 17 Left 917670673 1:177270597-177270619 CCTCTTTGGGTCACATCTTATTC 0: 1
1: 0
2: 0
3: 25
4: 173
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271
917670675_917670678 -5 Left 917670675 1:177270619-177270641 CCCACTTAAGGCTTGTTAGCTTC 0: 1
1: 0
2: 2
3: 13
4: 76
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271
917670672_917670678 20 Left 917670672 1:177270594-177270616 CCTCCTCTTTGGGTCACATCTTA 0: 1
1: 0
2: 0
3: 10
4: 159
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917670678 Original CRISPR GCTTCCTTCTTTCCTGGACC TGG Intronic