ID: 917670678

View in Genome Browser
Species Human (GRCh38)
Location 1:177270637-177270659
Sequence GCTTCCTTCTTTCCTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917670673_917670678 17 Left 917670673 1:177270597-177270619 CCTCTTTGGGTCACATCTTATTC 0: 1
1: 0
2: 0
3: 25
4: 173
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271
917670671_917670678 25 Left 917670671 1:177270589-177270611 CCTGTCCTCCTCTTTGGGTCACA 0: 1
1: 0
2: 3
3: 7
4: 200
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271
917670672_917670678 20 Left 917670672 1:177270594-177270616 CCTCCTCTTTGGGTCACATCTTA 0: 1
1: 0
2: 0
3: 10
4: 159
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271
917670676_917670678 -6 Left 917670676 1:177270620-177270642 CCACTTAAGGCTTGTTAGCTTCC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271
917670675_917670678 -5 Left 917670675 1:177270619-177270641 CCCACTTAAGGCTTGTTAGCTTC 0: 1
1: 0
2: 2
3: 13
4: 76
Right 917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917670678 Original CRISPR GCTTCCTTCTTTCCTGGACC TGG Intronic
900365695 1:2311153-2311175 GCTTCCTTCTTCCCTGCCCAGGG + Intergenic
901794681 1:11673451-11673473 GCTTCCTGCCATCCTGGCCCTGG - Intronic
901868182 1:12121486-12121508 GCTTCCTGCTTTTCTGGGGCAGG - Intronic
903615474 1:24651521-24651543 TTTTCCTTCTTTTCTGGAGCAGG - Exonic
905174488 1:36127220-36127242 CCCTGCTCCTTTCCTGGACCTGG - Intergenic
905210024 1:36367586-36367608 CCTGCCAGCTTTCCTGGACCTGG - Intronic
905408277 1:37752325-37752347 GCCACCTCCTTTCCTGGTCCCGG - Intronic
907178817 1:52552755-52552777 ACTTCTTTCTTTCCTGGAACGGG - Intronic
909836187 1:80258544-80258566 GCTTTCTGTTTTCCTGGTCCAGG - Intergenic
911567775 1:99483793-99483815 GTTTTCTTCTTTCCTCGACCTGG - Intergenic
911624222 1:100102950-100102972 GCTACCTTTGTTCCTGAACCAGG + Exonic
911833932 1:102591996-102592018 AATTCCTAATTTCCTGGACCAGG + Intergenic
913370318 1:118091962-118091984 GCTTTCTTCTTTCCAGGAGCTGG + Exonic
914433118 1:147637594-147637616 ACTTCCTTCATTCCAGTACCAGG + Intronic
915303720 1:154966149-154966171 GCTCCCTTCATACCTGGACAGGG + Exonic
915314922 1:155023104-155023126 GCTTCCTGCTCACCTGGACTCGG + Exonic
915668581 1:157467300-157467322 GCTTGCTTCTTGCCTGAATCAGG - Intergenic
915922236 1:159985071-159985093 ACTTCCTTCTGTCCTGGTGCAGG - Intergenic
916599282 1:166276373-166276395 GCTTTCTTGTTTCCTTGTCCAGG + Intergenic
916857633 1:168767022-168767044 GCTTCATTCTTTCAAGGATCTGG + Intergenic
917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG + Intronic
919392170 1:197000625-197000647 GCTTCCCTATTTCCTGGCACTGG + Intronic
919753295 1:201051791-201051813 GCTCCCTTCCTTCCTAGAGCAGG + Intronic
920104046 1:203537937-203537959 GATGGCTTCTTTCCTTGACCAGG - Intergenic
920904801 1:210152649-210152671 GTTTCTTTCATTCCTTGACCTGG - Intronic
921254988 1:213330988-213331010 TCTTCCTTCTTCCATGCACCAGG - Intergenic
921619003 1:217306027-217306049 TCTTCTCTCTTTCCTGGAGCTGG + Intergenic
923013418 1:230107005-230107027 GCTTCCTTCTGTCCAGCCCCGGG - Intronic
923400297 1:233610303-233610325 GCTGCCTTCCTTCCTCGTCCTGG - Intergenic
924160786 1:241229656-241229678 ACTTCCTTCTTTCCTCCCCCAGG + Intronic
924798240 1:247308544-247308566 GTTTCCTTCTTTCTTCTACCTGG + Exonic
1062916071 10:1242016-1242038 GCTTCCCTCTATCCTGGCACAGG - Intronic
1063379122 10:5573319-5573341 CCTTCCTTCTTTCCTTGACAAGG - Intergenic
1063754793 10:8995266-8995288 GCTACCTTCTTTCCCACACCTGG - Intergenic
1064326178 10:14353635-14353657 GGTTCCCTCTTGCCTGGTCCAGG + Intronic
1065660553 10:28000514-28000536 GCTTCCTTGCTTCCAGGACTGGG - Intergenic
1066480893 10:35794751-35794773 ACTGCCTTCCTTCCTAGACCAGG - Intergenic
1067041939 10:42959183-42959205 TCTTCCATCTTTCCAGTACCTGG + Intergenic
1070305237 10:75235498-75235520 GCTTCCGGCTTCCCTGGGCCGGG - Intronic
1070403855 10:76077151-76077173 CCTCCCTTCCTTCCTGGCCCTGG - Intronic
1073096644 10:100984068-100984090 GCTTCCTTTTTTCCAGGATGCGG - Exonic
1073212076 10:101812455-101812477 GCTTCCCACTTTCCTGGACTAGG + Intronic
1074562167 10:114544280-114544302 TCTTACTTCTTCCTTGGACCTGG + Intronic
1075253736 10:120907447-120907469 GTTTCATTCTTTTCTGGTCCTGG - Intronic
1075263491 10:120981868-120981890 GTTTCCTTCTATCCTGCTCCTGG - Intergenic
1075339436 10:121633540-121633562 GCTTTCATCTTTCCAGCACCAGG - Intergenic
1076517266 10:131053546-131053568 AGTTCCATCTCTCCTGGACCTGG - Intergenic
1076537950 10:131195052-131195074 CCTTCCTTCCCTCCTGGCCCAGG + Intronic
1076727883 10:132421821-132421843 GCTTCCTTCCTTCCTGGGTGTGG + Intergenic
1076730675 10:132437385-132437407 TCTGCCATCTTTCCTGCACCTGG - Intergenic
1077192377 11:1260831-1260853 CCTTCCCTCCTTCCTGGAGCTGG - Intronic
1078010547 11:7570029-7570051 GGGTCCTTCTTGCCTGGGCCAGG - Intronic
1078144080 11:8711228-8711250 GGTTCCTTCTTCCCTGCAGCTGG - Exonic
1078187718 11:9066470-9066492 CCTTCCTCCTCTCCTGGACTAGG - Intronic
1078285417 11:9949041-9949063 CCTTCTTTCTTTCCTTGTCCAGG - Intronic
1078689595 11:13565739-13565761 GCTTCCTACTCTTCTGGAACTGG - Intergenic
1078921155 11:15832018-15832040 GGATGTTTCTTTCCTGGACCAGG - Intergenic
1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG + Intronic
1081677150 11:44976894-44976916 GCTTCCTTCTCAGCTGGAGCAGG - Intergenic
1081750217 11:45505314-45505336 GCTTCCTTCTTCCCTTGTCTTGG + Intergenic
1082669050 11:56011016-56011038 GCATCCTTTTTTCCAGGCCCTGG - Intergenic
1083580209 11:63819815-63819837 GTTTCCTTGTTTCCTGGAATTGG + Intronic
1084611614 11:70206756-70206778 GATTCCTTCTGTGCTGGACACGG - Exonic
1084982253 11:72836135-72836157 GCTCTCCTCTTTCCTGGAGCTGG - Intronic
1085946050 11:81274875-81274897 GCTTCTTTGATTCCTGGGCCAGG + Intergenic
1087587755 11:100143574-100143596 CCTTCCTTTTTTCCCGGAACTGG - Intronic
1088927121 11:114313818-114313840 GCATCTTTCTTTCATGCACCAGG + Intergenic
1091028304 11:132161113-132161135 CCTTCCTTCTTGCCTGGCCAGGG + Intronic
1091286265 11:134410281-134410303 GCTTCCAGCTCACCTGGACCTGG + Intronic
1091644976 12:2266331-2266353 GCTTAATTATTTCCAGGACCTGG - Intronic
1092000985 12:5032210-5032232 GCTTCTCTGATTCCTGGACCAGG + Intergenic
1093525798 12:20102443-20102465 ACTTCATTCTGTCCTGGAGCGGG + Intergenic
1095612291 12:44144572-44144594 GATTGCTTCTTACCTGGAACAGG + Intronic
1097042036 12:56161585-56161607 GGTTCTTTCTTTCCTGAACAGGG + Intronic
1098112019 12:67133061-67133083 GGTGCCTTCTTTCCTGGTTCTGG + Intergenic
1098820387 12:75220576-75220598 GCCTCCTTCTTACCTGAAGCTGG + Intergenic
1100641786 12:96489459-96489481 GCATCATTGTTTTCTGGACCTGG + Intergenic
1101825204 12:108215033-108215055 AGTTCCTTCTTTGCTAGACCTGG + Intronic
1104244085 12:127020519-127020541 GCTCCTTTCTTTTCTGGTCCAGG + Intergenic
1106437467 13:29736058-29736080 GCTTCGTGCTGTACTGGACCTGG + Intergenic
1109892547 13:68634711-68634733 TCTTAATTCTTTCCAGGACCAGG + Intergenic
1110806936 13:79765586-79765608 AATGCCTTCTTTCCTGGACCTGG - Intergenic
1111795198 13:92910540-92910562 CCTTGGTTCTTACCTGGACCTGG - Intergenic
1112609355 13:100940727-100940749 GCATACATCTTTCCTGAACCTGG + Intergenic
1113955611 13:114098694-114098716 GGTTCCTTCTTCCCTGGGTCTGG - Intronic
1116324457 14:43514590-43514612 GTTTTCTTCTTTCTTGGAGCAGG - Intergenic
1116922146 14:50590131-50590153 CCTTCCTGCTGTCCTGGCCCTGG + Intronic
1118743547 14:68758290-68758312 TATTCTTTCTTTCATGGACCCGG - Intergenic
1119319031 14:73718589-73718611 TCCTCGTGCTTTCCTGGACCGGG - Exonic
1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG + Intronic
1121739001 14:96238387-96238409 GCTTCCTCTTCTCCTGGACGTGG - Intronic
1121862861 14:97336005-97336027 GCATCCTTCTGTCCTGGTCCTGG - Intergenic
1122175255 14:99912925-99912947 GGCTGCTTCTTTCCTGGAACGGG + Intronic
1122805553 14:104254766-104254788 GCTTCCTTCTTCCCTAGGTCAGG - Intergenic
1124514285 15:30353002-30353024 TCTTCCTGCTTTCCTGGCCTGGG - Intergenic
1124581509 15:30959615-30959637 TCTTCCTTCTTTCCCCGACGTGG + Intronic
1124728634 15:32177762-32177784 TCTTCCTGCTTTCCTGGCCTGGG + Intergenic
1126232344 15:46341835-46341857 GCTTCTTTCCTACCTGGACATGG + Intergenic
1128066526 15:64768173-64768195 ACTTACTTATTTCCTGTACCTGG - Intronic
1128764236 15:70241397-70241419 GCTTCCTTCTGTCCTGCCCAGGG - Intergenic
1129004771 15:72363354-72363376 CCTTCCACCTTTCCTGGACGTGG - Intronic
1130391577 15:83460105-83460127 CCTTCCTTCCTTCCTTGACAGGG + Intronic
1130553032 15:84904106-84904128 TCTTGCTGCTTTCCTGGGCCTGG + Exonic
1130808558 15:87352885-87352907 GCTTCCTTCTTCCCTACTCCAGG + Intergenic
1131657920 15:94481311-94481333 GCTTCCTTATTTCCCTTACCAGG + Exonic
1131731054 15:95281859-95281881 GCTTCTGGCTTTCCAGGACCTGG + Intergenic
1132295940 15:100734541-100734563 TCTTCCTTCTTTCCTCAAGCAGG + Intergenic
1132467740 16:85282-85304 GCTGCCTTCCTGCCTGGGCCAGG - Intronic
1134791040 16:16989518-16989540 ATTTCCTTCTCTCCTGGAACAGG - Intergenic
1136568173 16:31082112-31082134 GTTCCATTCTTTCCTGGAGCAGG + Intronic
1136578529 16:31138743-31138765 GATTCCTTCATTCCTGTCCCAGG - Intergenic
1138343858 16:56308089-56308111 TCTTCCTCCTTTCCTGCAGCTGG - Intronic
1138688164 16:58744724-58744746 GCTTCCTTCTTCCCCTGAACCGG + Intergenic
1140033911 16:71358849-71358871 GCTTCCATATTTCCAGGAACTGG - Exonic
1140224104 16:73065095-73065117 GTTTCCTTTTTTCCTGGCTCCGG - Intergenic
1141240397 16:82260253-82260275 CCTTCCTTCGTTCCTTGACAGGG + Intergenic
1141557607 16:84846257-84846279 CCTTCCTTCTTTTCTTGACAGGG + Intronic
1141921859 16:87140804-87140826 TCCTCCTTCTTTGCTGGACAGGG - Intronic
1142688291 17:1590585-1590607 CCTTCCCTCCCTCCTGGACCAGG + Intronic
1143136637 17:4716085-4716107 GCTCCCCGCTTTCCTGGGCCCGG - Intronic
1144466281 17:15500040-15500062 AGCTCCTTCTTTCCTGGAGCTGG - Intronic
1144778061 17:17794841-17794863 GCTTGCTGCTGTCCTTGACCAGG - Exonic
1147769301 17:42856637-42856659 GGTTCCCTCTTTCCTGTGCCAGG + Exonic
1148087997 17:45006294-45006316 GCTTCCTTCGTTCCTGGGAGGGG + Intergenic
1148392111 17:47280200-47280222 ACTTACTTCTTGCCTGGGCCAGG + Intronic
1148480960 17:47959146-47959168 GCTACCTTCCTCCATGGACCAGG + Intergenic
1148736690 17:49869201-49869223 GCTTACTTCCTGCCTGCACCAGG - Intergenic
1148875504 17:50684626-50684648 CCTCTCTTCTTCCCTGGACCTGG + Intronic
1149924341 17:60688107-60688129 ACTTCCTTTTTTCCTGTATCAGG - Intronic
1150302338 17:64056789-64056811 ACTTCCTTCTTTTGTGGACAAGG + Intronic
1150337543 17:64341672-64341694 GTGTCCTTCTTTCCTAGATCTGG + Exonic
1152305285 17:79516797-79516819 GCTTCCTTTCTTCCTGGGGCAGG - Intergenic
1153354831 18:4123271-4123293 CCTTTCTCCTTTCCTGCACCTGG - Intronic
1153654742 18:7272659-7272681 GCTACTTTCTTTCCTAGAGCAGG + Intergenic
1153847251 18:9061230-9061252 GATTCCTTCCTAGCTGGACCTGG + Intergenic
1157539932 18:48493625-48493647 GCTCCCTGCTTTGTTGGACCTGG - Intergenic
1157571131 18:48713130-48713152 GCCTCCTTCTTCCCTCTACCAGG - Intronic
1158707497 18:59805968-59805990 GCTTCCTTCTTTCCTCTTTCAGG - Intergenic
1160986339 19:1840711-1840733 GCTGCCCTGTCTCCTGGACCCGG + Intronic
1161229424 19:3165665-3165687 CCGTCCTCCTTTCCTGGACCAGG + Intergenic
1162083095 19:8231188-8231210 ACTTCCTTCTTTCCTGAGCATGG + Intronic
1162576166 19:11500209-11500231 TCTTCCATCTTTCCTGCCCCAGG + Intronic
1162592166 19:11599095-11599117 GCATCCTCCTTTCCTGGTCCTGG + Intronic
1163540013 19:17902921-17902943 GCTGCCTGCATTCTTGGACCTGG - Intergenic
1163633099 19:18426932-18426954 CCCTCCTTCCTTCCTGGGCCGGG + Intronic
1163638406 19:18448531-18448553 ACTTCCTTCTGGCCCGGACCAGG - Intronic
1165146621 19:33735015-33735037 GCCTCCTTCTTGCCTGGGCTGGG - Intronic
1166175645 19:41067368-41067390 GTTTCCTTCTTCCCAGGACAGGG + Intergenic
1166323979 19:42037935-42037957 GCTTCCTTCCCTCCTGCACAGGG + Intronic
1167288217 19:48610715-48610737 GCTGCCTGCCTTCCTGGAACTGG - Exonic
926224177 2:10955559-10955581 GCTTCCTCCTGCCCTGCACCTGG + Intergenic
926323854 2:11767538-11767560 GGTTCCATCTTTCCTGGTCAGGG + Intronic
926386798 2:12343207-12343229 GCTTCCTTCCTGGCTGGGCCAGG + Intergenic
927076981 2:19588531-19588553 GCTCCCTGCTTTCCTGGCCTCGG - Intergenic
927721183 2:25383616-25383638 GCTTCCTCATTTCCTGATCCTGG - Intronic
928471758 2:31582008-31582030 TCTTCCTTCTTTCTTCGACCCGG + Intergenic
929141567 2:38671070-38671092 GCTTCCCCCTTTCCTGGGCAAGG - Intronic
931709872 2:64979422-64979444 CCTTCCCTCTTTCCTTCACCCGG + Intergenic
935192395 2:100789327-100789349 GCTTACTTTTCTCCTGGACCTGG - Intergenic
937271856 2:120658013-120658035 TCTTCCTTCTTTCCAGGATGGGG + Intergenic
938919846 2:135985376-135985398 GTTTCCTCCTTTCCTGGGCCTGG - Intronic
939253695 2:139716170-139716192 GCTTTCCTCTTTTCTGAACCGGG - Intergenic
940069582 2:149670941-149670963 GCCTCTTTCTTTTCTGGACAGGG + Intergenic
940376840 2:152967262-152967284 GCTTCATTCTTTTCTGGAAATGG - Intergenic
941706721 2:168666317-168666339 CCTTCCTTCCTCCCTAGACCTGG + Intronic
943481555 2:188426419-188426441 ACTTACTTCTTTCCTGGATCAGG + Intronic
945515050 2:210752968-210752990 GCCTTCTTCCTTCCTTGACCAGG + Intergenic
946045728 2:216819434-216819456 CCTCCCTTCTTTCCTGGAATGGG + Intergenic
947864911 2:233389833-233389855 GCATCTTTCTCTCCAGGACCAGG + Intronic
948386769 2:237585540-237585562 TCTTCCTTCCTGCCTGGACTTGG - Intronic
1170481205 20:16766588-16766610 GCTTCCTTCTCTCTGGGATCTGG + Intronic
1172566010 20:35931015-35931037 ACTTCCTCATTTCCTGGAACTGG - Intronic
1172801939 20:37581979-37582001 GCTTCCCTCTTTCATGGGGCTGG + Intergenic
1173702036 20:45080855-45080877 CCTTCCTTCTTTCCTTCATCTGG - Intergenic
1174398118 20:50260524-50260546 TCTTCCTTCTATCTTTGACCTGG + Intergenic
1175394037 20:58646432-58646454 GCTTTTTTCTTTCCAGGACTTGG - Intergenic
1179384090 21:40925560-40925582 GACTCTTTCTTTCCTGCACCTGG + Intergenic
1179416065 21:41199561-41199583 GCTTCCTTCTGTCCTGTGCTAGG + Intronic
1179462176 21:41543858-41543880 CCTTCCTTCTCTCCTGGAATAGG + Intergenic
1179839116 21:44058815-44058837 GTTTCCTGCTGTCCAGGACCTGG - Intronic
1181541509 22:23575423-23575445 GCTGACTTCCTCCCTGGACCAGG + Intronic
1181796872 22:25317879-25317901 GCTGACTTCCTCCCTGGACCAGG - Intergenic
1182191421 22:28464858-28464880 GCTTCCTTCTGTTCTGGAAGAGG - Intronic
1182455065 22:30445078-30445100 GCTTACCTCTTTCCTGGGCAGGG + Intergenic
1183229281 22:36570842-36570864 GCTTCCTTCCCACCTGGATCTGG - Intronic
1183364496 22:37399864-37399886 CCTTCCTTCTTTCATTTACCAGG - Intronic
1184672656 22:46023545-46023567 CCTTCCTTCTCTCCTGGGCCCGG + Intergenic
1185013331 22:48328800-48328822 GCCTCCTTCTGTCCTGCCCCTGG + Intergenic
1185366354 22:50438714-50438736 GCTTCCTTCTTCCCGGGGGCCGG - Exonic
949862812 3:8522008-8522030 ACTTACTTCTTTCATGGCCCAGG + Intronic
950856457 3:16110152-16110174 GCTTCCTTCCTTCCCTGCCCTGG + Intergenic
951252375 3:20409126-20409148 GGCTAGTTCTTTCCTGGACCTGG + Intergenic
951711125 3:25585674-25585696 GGGTCCTTCCTTCCTGGACAGGG + Intronic
952553482 3:34505124-34505146 GGTTACTGATTTCCTGGACCAGG + Intergenic
952847974 3:37704341-37704363 GCTGCCAGCTTTCCAGGACCTGG - Intronic
953345692 3:42173431-42173453 GCTTCCTTATTTCTTGGAACAGG + Intronic
955463612 3:59212723-59212745 CTTTCCTGCTTTCCTGGACTGGG + Intergenic
955808891 3:62765373-62765395 GCTGCTTTCTTTTCTGGAGCTGG - Intronic
956397442 3:68841008-68841030 GCTTCCATCTTTCCTCTACAAGG + Intronic
959434829 3:106301786-106301808 GCCACCTTCTTTCCTGAAGCTGG + Intergenic
960198133 3:114796189-114796211 GAATCCTTCTTTCCTTGACCTGG - Intronic
963791348 3:149585885-149585907 GCTTCCTGCATTTCTGTACCTGG - Intronic
964870023 3:161303393-161303415 TCCTCCTTCTTACCTGGCCCTGG + Intergenic
966669643 3:182512940-182512962 GATGTCTTCTTTCCTGCACCTGG - Intergenic
966853496 3:184178479-184178501 GTCTCTTTCTGTCCTGGACCTGG + Intronic
967765004 3:193269444-193269466 GTGTCCCTCTTTCCTGGCCCTGG + Intronic
968572419 4:1348900-1348922 CCTTCCTTCCTTCCTGCAGCAGG + Intronic
969092141 4:4702809-4702831 CCTTCCTTCCTTCCTTGACAGGG - Intergenic
969676522 4:8617379-8617401 GCATCCTCCTTCCCTGGCCCCGG - Intronic
970495225 4:16618215-16618237 GCTTCCATTTTCACTGGACCGGG + Intronic
972347159 4:38201999-38202021 GTTTCCTTCATTCCCGGGCCAGG - Intergenic
973647721 4:52967001-52967023 TCTTCCTTCCCTCCAGGACCTGG + Intronic
973870028 4:55157526-55157548 GCTCCCTTCCTTCCTAGAGCAGG + Intergenic
979486255 4:121274391-121274413 TCATCCTCCTTTCCTGGACCTGG - Intergenic
979699617 4:123653318-123653340 TCTTCCTTCTTTCCTTTTCCTGG + Intergenic
981404118 4:144347298-144347320 GTTTCCTTTTTTCCTTGACGTGG - Intergenic
981821695 4:148894432-148894454 GCTTCATACTTTCCTGGAGCTGG - Intergenic
982004368 4:151049799-151049821 GATTCCTCCTTTCCTTAACCAGG - Intergenic
983797956 4:171889332-171889354 GCTTCAGTCTTTCATTGACCTGG + Intronic
986266098 5:6192331-6192353 GTTTCCTTCTTTACAGGTCCTGG - Intergenic
987080556 5:14421759-14421781 GCTGCCTGGTTTCCTGGACGTGG - Intronic
987377296 5:17247892-17247914 GCCTCCCTCTTTCCTGGAAAAGG + Intronic
989097269 5:37792985-37793007 CCTCCCTTCTCTCCTGGACTTGG + Intergenic
989356512 5:40549601-40549623 GCTTCACTCTTGACTGGACCAGG - Intergenic
991163647 5:63535275-63535297 GTTTCTTTCTTTTCTAGACCAGG - Intergenic
993115928 5:83720977-83720999 GCCTCCTTCTTCCCAGGATCAGG - Exonic
994768332 5:103951109-103951131 TCTCCCTTATTTCCTGAACCTGG + Intergenic
995285305 5:110381792-110381814 ACTTCCTTCTGTCATGGACTGGG + Intronic
996913726 5:128685865-128685887 TGTTCCTTCTTTCCTGGTCCAGG + Intronic
998103968 5:139456775-139456797 ACCTCTTTCTTTCCTGAACCAGG + Intronic
999801983 5:155046832-155046854 GCTCCCTGCTCTCCTGCACCTGG + Intergenic
1000498641 5:162019843-162019865 GCTTCCTTCTCTCTAGGACCAGG + Intergenic
1001202784 5:169734520-169734542 GTTTCCTTCTTTCATTCACCTGG + Intronic
1001990280 5:176110892-176110914 GAGTCCTCCTTTGCTGGACCAGG + Intronic
1002226592 5:177727248-177727270 GAGTCCTCCTTTGCTGGACCAGG - Intronic
1002267252 5:178043965-178043987 GAGTCCTCCTTTGCTGGACCAGG + Intronic
1003173258 6:3736619-3736641 CCTTCCTTCCTTCCTGTGCCAGG + Intronic
1005175969 6:23045281-23045303 CCTTCCTTCCTTCCTGTACTTGG - Intergenic
1005347381 6:24903980-24904002 GCTGCCTTCCTTACTGGAGCTGG + Intronic
1006093815 6:31643781-31643803 GGTTCCTGCTTTCCTGGAATGGG - Intronic
1006641667 6:35492510-35492532 GCTTCCCTCCTTCCTGGAACAGG + Intronic
1006922652 6:37636788-37636810 CCTTCCTTGTCTCCTGGACGTGG + Exonic
1007907221 6:45473931-45473953 GCCTGCTTCTTTCCAGGACCTGG - Intronic
1008278904 6:49572528-49572550 CCTTCCTTCCTTCCTTGACAGGG + Intergenic
1008555752 6:52671485-52671507 GCCTCCTACCTTCCTGGATCTGG + Intronic
1010915573 6:81613883-81613905 CCTTCCTTCTTCCCTGTTCCAGG - Intronic
1011592618 6:88985082-88985104 ACTTCCTTCTTCCCTCAACCTGG - Intergenic
1016329819 6:142944939-142944961 CCTTCCTTCCTTCCTTGCCCGGG + Intronic
1019715598 7:2537931-2537953 CCTTGCTTCTCTCCTGGTCCTGG + Exonic
1019740920 7:2672783-2672805 CCTTGCTTCTCTCCTGGTCCTGG - Intergenic
1020387079 7:7618569-7618591 TCTTCCTTCCTTCCTTGACAGGG + Intergenic
1020804601 7:12772879-12772901 GCTAGCTTCTTTACTGGAACTGG + Intergenic
1021505259 7:21377027-21377049 TCTTCCTTCTCTCCTGATCCTGG - Intergenic
1023203674 7:37725111-37725133 GGTTCCTTCTCTCCTGGAGATGG + Intronic
1024990460 7:55231373-55231395 GCTTCAGTCCTTCCTGCACCTGG + Intronic
1026492091 7:70872035-70872057 CCTTCCTTCTTTCTTTGACAGGG - Intergenic
1026786900 7:73307570-73307592 CCTTCCAGCTTACCTGGACCAGG + Exonic
1026804000 7:73418252-73418274 CCTTCCTTCTTCCCTGCACCTGG - Intergenic
1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG + Intronic
1030554896 7:111011555-111011577 GTGGCCTTCTTTTCTGGACCAGG + Intronic
1030924378 7:115433367-115433389 GTTTCTGTCTTTCCTGGATCTGG + Intergenic
1034441844 7:151089643-151089665 GCTTCCTCCTGTCCTGGACACGG - Intronic
1034497943 7:151433262-151433284 CCTTCCTGCTTTTCTGGGCCGGG - Intronic
1034932159 7:155171266-155171288 TATTCCTTCTTACCTTGACCTGG - Intergenic
1035386721 7:158477949-158477971 GCCTCCCTCTTTCCTGGCCAAGG - Intronic
1035493003 7:159296158-159296180 GCTTCCTTCCTTCCAGTAGCGGG + Intergenic
1035765288 8:2100400-2100422 GCTTGGTGCTTGCCTGGACCTGG + Intronic
1035777083 8:2196387-2196409 GCTTTCTTCTCTCCTGGCCAGGG - Intergenic
1036756448 8:11474456-11474478 GCTTGCTGCTTTCCTGGGCCAGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1040717279 8:50272413-50272435 GCTTCTTTGATTCCTGGGCCAGG + Intronic
1040797837 8:51306335-51306357 TCCTGCTTCTTTGCTGGACCTGG - Intergenic
1041049086 8:53915595-53915617 GCTTCCCTTTTTCCTAGACCTGG + Intronic
1044412692 8:91901963-91901985 GCTCCCTTGTTTCCTGGGACAGG + Intergenic
1045913478 8:107438101-107438123 GCTTTCTTCCTTCCTAGACTTGG - Intronic
1046692433 8:117300875-117300897 GCTGTCTTCTTTCCTGGTCTTGG + Intergenic
1048471998 8:134712458-134712480 GCTTCCTTCTTGCCTGGCCTCGG - Intronic
1048758869 8:137769280-137769302 GCTTTCTTTTACCCTGGACCAGG + Intergenic
1051732126 9:20155056-20155078 CCTTCCTTCTTTCCTTGATGGGG - Intergenic
1053152962 9:35754533-35754555 GCTTCCTTCTCTCCAGGTCAGGG - Exonic
1055149693 9:72981553-72981575 GCTTTCTTGTTTCCTAGATCTGG + Intronic
1055551392 9:77434960-77434982 GCCTCCTTATTGCCTGTACCAGG - Intronic
1056890694 9:90488950-90488972 CCTTCCTTCTGACCTGGGCCTGG - Intergenic
1056954625 9:91072287-91072309 GCTGCCTCCTTTCCAGCACCAGG - Intergenic
1059754415 9:117279120-117279142 GCTGCCTTCTTCCATGGTCCAGG + Intronic
1061529384 9:131198247-131198269 GCTTCCTCCTTTTCTGTGCCTGG + Exonic
1061873200 9:133531516-133531538 GCTGGCTTCTATCCTGGGCCAGG + Intergenic
1062168694 9:135122302-135122324 GCTCCCTTGTTACCTGGCCCTGG + Intergenic
1185637200 X:1561460-1561482 CCTTCCTTCCTTCCTTGACAGGG + Intergenic
1185911618 X:3986337-3986359 CCTTCCTTCCTTCCTGGAAGTGG - Intergenic
1188391712 X:29629096-29629118 GATTTCTTATTTCCTGGACCTGG + Intronic
1192059844 X:67812684-67812706 GCTTCCTTCTATCCGTGCCCAGG - Intergenic
1194580698 X:95666670-95666692 GCCTCATTCTTTCCTGCAGCTGG - Intergenic
1195098622 X:101531177-101531199 GCTTCCTTCCTTCCTTTACAAGG + Intronic
1196287387 X:113898314-113898336 TCTTAGTTCTTTCCTGGATCAGG + Intergenic
1198474855 X:136985058-136985080 TTTTCCTTCTTTTCTGGAGCAGG + Intergenic
1200000601 X:153058012-153058034 GCCTCCTGGTTTCCTGGCCCTGG + Exonic
1200054153 X:153450017-153450039 GCTTCCTTCTCTCCTGCATGGGG + Intronic
1201994759 Y:20073367-20073389 TCTTCCTTCTGTCCTGTACATGG - Intergenic
1201999782 Y:20140130-20140152 TCTTCCTTCTGTCCTGTACATGG + Intergenic