ID: 917670688

View in Genome Browser
Species Human (GRCh38)
Location 1:177270701-177270723
Sequence AGTGAAAAACCCAATGACGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917670682_917670688 23 Left 917670682 1:177270655-177270677 CCTGGTTGGTGAGTGACCAAGTC 0: 1
1: 0
2: 1
3: 4
4: 91
Right 917670688 1:177270701-177270723 AGTGAAAAACCCAATGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 116
917670685_917670688 7 Left 917670685 1:177270671-177270693 CCAAGTCAGGAGTAAGTGGATGG 0: 1
1: 0
2: 0
3: 4
4: 167
Right 917670688 1:177270701-177270723 AGTGAAAAACCCAATGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 116
917670681_917670688 29 Left 917670681 1:177270649-177270671 CCTGGACCTGGTTGGTGAGTGAC 0: 1
1: 0
2: 0
3: 7
4: 116
Right 917670688 1:177270701-177270723 AGTGAAAAACCCAATGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917670688 Original CRISPR AGTGAAAAACCCAATGACGA CGG Intronic
907073895 1:51561990-51562012 ATTGAAAATCCCAATTACCAGGG - Intergenic
908311789 1:62891559-62891581 ATTGAAAAACCCTTTGAAGAGGG - Intergenic
908523200 1:64965251-64965273 AGAGAAAAACCCTATGACTTGGG + Intronic
909346852 1:74599871-74599893 GGTGAAAAATCTAATGAAGAAGG - Exonic
913381980 1:118221954-118221976 AGTGACAAACCAACTGACCATGG - Intergenic
915023878 1:152807885-152807907 AGTGAGAATTCCAATGATGATGG - Intronic
917670688 1:177270701-177270723 AGTGAAAAACCCAATGACGACGG + Intronic
921749152 1:218772900-218772922 AGTGTAAAAGCAAATGACTATGG - Intergenic
923211515 1:231808084-231808106 AGTGAAAAACCCAAGTTTGACGG - Intronic
923406562 1:233666790-233666812 AGTGACAAACCCAAGGAGCACGG - Exonic
924110439 1:240693540-240693562 AGTGAGAAACCCAACGAGAAGGG - Intergenic
1063560557 10:7122413-7122435 AGAGAAAATACCAATGACGGAGG + Intergenic
1063710512 10:8472829-8472851 AGTGAAACAGCCCATGACCAAGG + Intergenic
1067458036 10:46437468-46437490 AGTGAAAAAACTAGTGAAGAGGG + Intergenic
1067629161 10:47947166-47947188 AGTGAAAAAACTAGTGAAGAGGG - Intergenic
1073190385 10:101646651-101646673 AGTGAGAAACCCAGGGAAGAAGG - Intronic
1074901407 10:117819241-117819263 AGTGAAACACCCTAAGAGGAGGG + Intergenic
1076229392 10:128807739-128807761 ACTGCAAAACCCAATGGCCAAGG + Intergenic
1080138497 11:28887100-28887122 AGAGAAAAACCCAATGACATTGG - Intergenic
1082996396 11:59259110-59259132 AGTGAAAGGGCCAATGAGGAGGG - Intergenic
1083132579 11:60639442-60639464 AGTCAAAAACCCATAGACGTTGG + Intergenic
1089791995 11:120952291-120952313 AGTGAAGAAGCCAAAGCCGAGGG - Intronic
1089932986 11:122333186-122333208 AGTGAAAAACAGAATGAGGTGGG - Intergenic
1093772890 12:23038004-23038026 ACTGGAAAACACAATGAAGATGG - Intergenic
1095741949 12:45617105-45617127 AGTGAAAAGCACAAACACGAAGG - Intergenic
1097885780 12:64727619-64727641 AGTGAAAAAACCAGTTACAAGGG + Intronic
1098671972 12:73242092-73242114 AGTCAAAAACCAAATGACAATGG + Intergenic
1098983045 12:76979980-76980002 AGTGAAAAACTAAAAGACAAAGG - Intergenic
1103504442 12:121432272-121432294 ACTGCAAAATCCAATGATGAAGG + Intronic
1105267308 13:18832782-18832804 AGTGAAAAAGCCAGTCACAAAGG + Intergenic
1112147775 13:96720436-96720458 AGTGCAAAACCCAAGGATGGTGG - Intronic
1113605582 13:111602874-111602896 AGTGAAAAACCCAAGGCAGTGGG + Intronic
1117609918 14:57472323-57472345 AATGAAAAAGACAATGAAGATGG - Intronic
1120429398 14:84395602-84395624 AATGAAGAACTCAATGACCAAGG - Intergenic
1202831463 14_GL000009v2_random:38696-38718 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1128438056 15:67675325-67675347 AGTGAAAAAGCCAGTCACAAAGG + Intronic
1132028115 15:98420057-98420079 AGTGTAAACCCCAATGTCGCAGG + Intergenic
1133483346 16:6193770-6193792 AGTGACAAACCCAGTGGGGAGGG - Intronic
1138999702 16:62494636-62494658 TGTGAAAAAGGCAATGAGGATGG + Intergenic
1146786221 17:35724256-35724278 ACTGAAAATCCAAATGACCAGGG - Intronic
1149720419 17:58838340-58838362 AGTGAACAACCCAATTAAAAAGG + Intronic
1151290085 17:73143487-73143509 AGAGAAACAACCAATGATGAGGG + Intergenic
1151432965 17:74077105-74077127 AGTTAAAAACCCAATGCAAATGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1154421105 18:14228648-14228670 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1154487241 18:14882340-14882362 GGTGAAAAACGAAATCACGATGG - Intergenic
1157748554 18:50158649-50158671 AGTGAAAAACCCAAGGCCCAAGG + Intronic
1159451740 18:68611426-68611448 AGTGAAACACCCAATTCCGGGGG + Intergenic
1164919191 19:32076176-32076198 AGTGAAAGAGCCATTGACAAAGG - Intergenic
1202641235 1_KI270706v1_random:89044-89066 AGTGAAAAAGCCAGTCACAAAGG + Intergenic
928615438 2:33034044-33034066 AGTCACAAACCCAATTAGGACGG - Intronic
935743213 2:106169346-106169368 ACTGAAAAAGCAAATAACGATGG - Intronic
940601531 2:155867903-155867925 AGTGAAAAACACAATTGCCAAGG + Intergenic
943820754 2:192317136-192317158 AGTTAAATACCAAATGACAAGGG + Intergenic
944304348 2:198162341-198162363 AGTCAAAAATCCAATAAAGATGG - Intronic
947309313 2:228783072-228783094 AGTGAATCACCCAATGCCTAAGG - Intergenic
1171888339 20:30679255-30679277 AGTGAAAAAGCCAGTCACAAAGG + Intergenic
1172351468 20:34245797-34245819 AGTGAAAATGCCAAGGACGAGGG + Intronic
1175668200 20:60878118-60878140 AGAGAAAAACCTAAGGAGGAAGG + Intergenic
1176610650 21:8883527-8883549 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1176852370 21:13931313-13931335 AGTGAAAAAGCCAGTCACAAAGG + Intergenic
1177364925 21:20122576-20122598 ATTGCAAAACCCAATTACGGTGG - Intergenic
1179911755 21:44454537-44454559 ATTGACAAACCAAATGACGCAGG + Intergenic
1180652881 22:17393279-17393301 AATGAAAAATCCAATCACAAAGG - Intronic
1184964247 22:47956431-47956453 TGTGTGCAACCCAATGACGAAGG - Intergenic
951572240 3:24076650-24076672 AGTCAAAAACAAAATGAAGATGG - Intergenic
951895998 3:27610224-27610246 AGTGGTAAACACATTGACGATGG - Intergenic
954539308 3:51383142-51383164 AGAGAAAAACACACTGACCATGG - Exonic
960362217 3:116726825-116726847 AGTGAAAAAGCCAAGGACATAGG + Intronic
961177680 3:124849242-124849264 AGAGAAAGACCCAGTCACGATGG + Intronic
965216144 3:165867431-165867453 AGTGGAAAACCCAATTTAGAAGG + Intergenic
965585537 3:170314600-170314622 AGTGTAAACCCCAAAGACGTAGG - Intergenic
1202737333 3_GL000221v1_random:18313-18335 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
971697602 4:29926604-29926626 ACAGAAAAACCCAAAGAGGAAGG - Intergenic
981642407 4:146959774-146959796 AGTGAAAGATACAATGATGAAGG - Intergenic
988073219 5:26321839-26321861 AGTAAAAAACCCAATCTCAAAGG - Intergenic
990827793 5:59921928-59921950 AGTGAAAAAGGCACTGAAGAGGG + Intronic
995472761 5:112520858-112520880 AGTGAAAAACGAAATCAAGATGG - Intergenic
996306757 5:122055770-122055792 AATTAAAAACACAATGAGGATGG + Intronic
1001373027 5:171225661-171225683 AGAGAAGAACCCAGTGAGGATGG - Intronic
1004812649 6:19276561-19276583 AGTGCAAAAACCAAAGAAGATGG + Intergenic
1011409387 6:87051274-87051296 AGAGAAAATTCTAATGACGAAGG + Intergenic
1011492524 6:87907088-87907110 AGTGTAAAAACCAATGGAGATGG + Intergenic
1012508959 6:99980693-99980715 AGTGAAAATCCCAATATAGAGGG - Intronic
1014033336 6:116735802-116735824 AGAGAAAAAACAAATGAAGATGG + Intronic
1020999322 7:15308460-15308482 AGTGAAAAACACCATGATGTAGG - Intronic
1027275985 7:76556506-76556528 AGTGAAAAGACTAATGAAGAAGG + Intergenic
1027936296 7:84607821-84607843 AGGGAAAAATCCAATGAAAAAGG + Intergenic
1028136314 7:87226832-87226854 AGGGAAAAACCAAATCAAGATGG + Intergenic
1028419692 7:90619087-90619109 AGTGAAATACCCAATGGAGGTGG - Intronic
1029133072 7:98348807-98348829 AGTAAATAACCCACTGCCGAAGG + Intronic
1033999091 7:147389116-147389138 AGTCAAAAACCCATTGAGCAGGG - Intronic
1034649516 7:152678677-152678699 AGTGAAAAAGGCAAAGAGGAAGG + Intergenic
1035564527 8:632606-632628 AGTGAAAAACCCAAAGAAAGGGG + Intronic
1036181498 8:6589214-6589236 AGTGAAAAAGCCATTGATTAAGG - Intronic
1041688062 8:60662462-60662484 AATAAAAAACCCAATGAGGGTGG - Intergenic
1043265589 8:78264425-78264447 AGTGAAGAATGCAATGAGGAGGG + Intergenic
1044397775 8:91734077-91734099 AGTGAAAACCCCAATTTTGAAGG + Intergenic
1048080168 8:131118109-131118131 AGTGAAAAACCCAGAGCAGATGG - Intergenic
1050210448 9:3248544-3248566 AGTGAAAATCCTATTGATGAAGG + Intronic
1050574035 9:6974016-6974038 ATTGAAAAACCCAAAGAGGCTGG + Intronic
1053660104 9:40267992-40268014 AGTGAAAAAGCCAGTCACAAAGG - Intronic
1053888172 9:42661085-42661107 GGTGAAAAACGAAATCACGATGG - Intergenic
1053910478 9:42897347-42897369 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1054107053 9:61064670-61064692 AGTGACAAACACCATTACGAAGG + Intergenic
1054227192 9:62468535-62468557 GGTGAAAAACGAAATCACGATGG - Intergenic
1054361099 9:64120702-64120724 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1054372237 9:64414296-64414318 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1054524494 9:66108225-66108247 AGTGAAAAAGCCAGTCACAAAGG + Intronic
1054613804 9:67266455-67266477 AGTGACAAACACCATTACGAAGG - Intergenic
1054679855 9:67903993-67904015 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1056981938 9:91321515-91321537 AAAGCAAAACCCAATGACAAAGG + Intronic
1203693496 Un_GL000214v1:68762-68784 AGTGAAAAAGCCAGTCACAAAGG + Intergenic
1203706056 Un_KI270742v1:48763-48785 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1203557946 Un_KI270744v1:17129-17151 AGTGAAAAAGCCAGTCACAAAGG + Intergenic
1203642777 Un_KI270751v1:35301-35323 AGTGAAAAAGCCAGTCACAAAGG - Intergenic
1188008264 X:25032947-25032969 AGTGAAAAACTCAATAACCTGGG - Intergenic
1189608876 X:42710125-42710147 AATGAAAAACACAGTGACAAGGG - Intergenic
1189878907 X:45468710-45468732 AGTCAAAAACAAAATGAAGATGG - Intergenic
1189996426 X:46643289-46643311 AGTGAAGAACACAATGAGAAGGG + Exonic
1194475467 X:94354038-94354060 AGTTAAAAACCCATTGAAGCTGG + Intergenic