ID: 917672488

View in Genome Browser
Species Human (GRCh38)
Location 1:177286106-177286128
Sequence GTGTGGGGATGGAGGAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917672484_917672488 -10 Left 917672484 1:177286093-177286115 CCAGGCCTTAGGAGTGTGGGGAT No data
Right 917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG No data
917672480_917672488 -5 Left 917672480 1:177286088-177286110 CCTGGCCAGGCCTTAGGAGTGTG No data
Right 917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG No data
917672479_917672488 -4 Left 917672479 1:177286087-177286109 CCCTGGCCAGGCCTTAGGAGTGT No data
Right 917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG No data
917672475_917672488 13 Left 917672475 1:177286070-177286092 CCTAGAGATGACAGGGACCCTGG No data
Right 917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917672488 Original CRISPR GTGTGGGGATGGAGGAGAGA AGG Intergenic
No off target data available for this crispr