ID: 917679935

View in Genome Browser
Species Human (GRCh38)
Location 1:177355337-177355359
Sequence GGGGGTCTGTGCCAAGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917679924_917679935 25 Left 917679924 1:177355289-177355311 CCACAATGTCAGAAGACAATGGG No data
Right 917679935 1:177355337-177355359 GGGGGTCTGTGCCAAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917679935 Original CRISPR GGGGGTCTGTGCCAAGCTGA AGG Intergenic
No off target data available for this crispr