ID: 917680709

View in Genome Browser
Species Human (GRCh38)
Location 1:177363957-177363979
Sequence ACTGATGTGCATATAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917680709_917680711 2 Left 917680709 1:177363957-177363979 CCTTCCACTATATGCACATCAGT No data
Right 917680711 1:177363982-177364004 ATTGCTTAAAATCCAATAGAAGG No data
917680709_917680714 16 Left 917680709 1:177363957-177363979 CCTTCCACTATATGCACATCAGT No data
Right 917680714 1:177363996-177364018 AATAGAAGGTGTACTTGGCTTGG No data
917680709_917680712 11 Left 917680709 1:177363957-177363979 CCTTCCACTATATGCACATCAGT No data
Right 917680712 1:177363991-177364013 AATCCAATAGAAGGTGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917680709 Original CRISPR ACTGATGTGCATATAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr