ID: 917680711

View in Genome Browser
Species Human (GRCh38)
Location 1:177363982-177364004
Sequence ATTGCTTAAAATCCAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917680710_917680711 -2 Left 917680710 1:177363961-177363983 CCACTATATGCACATCAGTTCAT No data
Right 917680711 1:177363982-177364004 ATTGCTTAAAATCCAATAGAAGG No data
917680709_917680711 2 Left 917680709 1:177363957-177363979 CCTTCCACTATATGCACATCAGT No data
Right 917680711 1:177363982-177364004 ATTGCTTAAAATCCAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917680711 Original CRISPR ATTGCTTAAAATCCAATAGA AGG Intergenic
No off target data available for this crispr