ID: 917680712

View in Genome Browser
Species Human (GRCh38)
Location 1:177363991-177364013
Sequence AATCCAATAGAAGGTGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917680709_917680712 11 Left 917680709 1:177363957-177363979 CCTTCCACTATATGCACATCAGT No data
Right 917680712 1:177363991-177364013 AATCCAATAGAAGGTGTACTTGG No data
917680710_917680712 7 Left 917680710 1:177363961-177363983 CCACTATATGCACATCAGTTCAT No data
Right 917680712 1:177363991-177364013 AATCCAATAGAAGGTGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917680712 Original CRISPR AATCCAATAGAAGGTGTACT TGG Intergenic
No off target data available for this crispr