ID: 917683199

View in Genome Browser
Species Human (GRCh38)
Location 1:177388791-177388813
Sequence CATATCCATTATTCAGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917683199_917683202 19 Left 917683199 1:177388791-177388813 CCATGAGCTGAATAATGGATATG No data
Right 917683202 1:177388833-177388855 CACTTATGGCCAATGTGATGAGG No data
917683199_917683201 5 Left 917683199 1:177388791-177388813 CCATGAGCTGAATAATGGATATG No data
Right 917683201 1:177388819-177388841 TCTTCTGATGGCATCACTTATGG No data
917683199_917683200 -7 Left 917683199 1:177388791-177388813 CCATGAGCTGAATAATGGATATG No data
Right 917683200 1:177388807-177388829 GGATATGTATGTTCTTCTGATGG No data
917683199_917683203 20 Left 917683199 1:177388791-177388813 CCATGAGCTGAATAATGGATATG No data
Right 917683203 1:177388834-177388856 ACTTATGGCCAATGTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917683199 Original CRISPR CATATCCATTATTCAGCTCA TGG (reversed) Intergenic
No off target data available for this crispr