ID: 917683200

View in Genome Browser
Species Human (GRCh38)
Location 1:177388807-177388829
Sequence GGATATGTATGTTCTTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917683197_917683200 8 Left 917683197 1:177388776-177388798 CCATTAGGGAATGAGCCATGAGC No data
Right 917683200 1:177388807-177388829 GGATATGTATGTTCTTCTGATGG No data
917683199_917683200 -7 Left 917683199 1:177388791-177388813 CCATGAGCTGAATAATGGATATG No data
Right 917683200 1:177388807-177388829 GGATATGTATGTTCTTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917683200 Original CRISPR GGATATGTATGTTCTTCTGA TGG Intergenic
No off target data available for this crispr