ID: 917687598

View in Genome Browser
Species Human (GRCh38)
Location 1:177433253-177433275
Sequence GTGCCATTTGCTTCTCGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917687598_917687600 -10 Left 917687598 1:177433253-177433275 CCACTCCGAGAAGCAAATGGCAC No data
Right 917687600 1:177433266-177433288 CAAATGGCACAGCCACCACTAGG No data
917687598_917687603 8 Left 917687598 1:177433253-177433275 CCACTCCGAGAAGCAAATGGCAC No data
Right 917687603 1:177433284-177433306 CTAGGCCCATTTTACAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917687598 Original CRISPR GTGCCATTTGCTTCTCGGAG TGG (reversed) Intergenic