ID: 917691287

View in Genome Browser
Species Human (GRCh38)
Location 1:177472070-177472092
Sequence GTTTATATGCAGGAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917691287_917691292 10 Left 917691287 1:177472070-177472092 CCCTGCAGCTCCTGCATATAAAC No data
Right 917691292 1:177472103-177472125 TGTTTTTGCCTCACTTACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917691287 Original CRISPR GTTTATATGCAGGAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr