ID: 917692833

View in Genome Browser
Species Human (GRCh38)
Location 1:177486736-177486758
Sequence CCTTCCTTGTGGAAACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917692833_917692840 -4 Left 917692833 1:177486736-177486758 CCTCCCAGTTTCCACAAGGAAGG No data
Right 917692840 1:177486755-177486777 AAGGGGTAGAATGATCCAAGTGG No data
917692833_917692841 -3 Left 917692833 1:177486736-177486758 CCTCCCAGTTTCCACAAGGAAGG No data
Right 917692841 1:177486756-177486778 AGGGGTAGAATGATCCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917692833 Original CRISPR CCTTCCTTGTGGAAACTGGG AGG (reversed) Intergenic
No off target data available for this crispr