ID: 917693728

View in Genome Browser
Species Human (GRCh38)
Location 1:177495988-177496010
Sequence CAGCCCGAATACCCTCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917693719_917693728 25 Left 917693719 1:177495940-177495962 CCACCAGGACAGTCTTCCAGGCT No data
Right 917693728 1:177495988-177496010 CAGCCCGAATACCCTCCCCTTGG No data
917693723_917693728 -8 Left 917693723 1:177495973-177495995 CCCAGCCTTCCCACACAGCCCGA No data
Right 917693728 1:177495988-177496010 CAGCCCGAATACCCTCCCCTTGG No data
917693722_917693728 9 Left 917693722 1:177495956-177495978 CCAGGCTCAGGTCTCTGCCCAGC No data
Right 917693728 1:177495988-177496010 CAGCCCGAATACCCTCCCCTTGG No data
917693720_917693728 22 Left 917693720 1:177495943-177495965 CCAGGACAGTCTTCCAGGCTCAG No data
Right 917693728 1:177495988-177496010 CAGCCCGAATACCCTCCCCTTGG No data
917693724_917693728 -9 Left 917693724 1:177495974-177495996 CCAGCCTTCCCACACAGCCCGAA No data
Right 917693728 1:177495988-177496010 CAGCCCGAATACCCTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917693728 Original CRISPR CAGCCCGAATACCCTCCCCT TGG Intergenic
No off target data available for this crispr