ID: 917693803

View in Genome Browser
Species Human (GRCh38)
Location 1:177497029-177497051
Sequence AAATTACCCTTCAGTAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917693800_917693803 2 Left 917693800 1:177497004-177497026 CCAACTAAGAATAGTGTACCCAG No data
Right 917693803 1:177497029-177497051 AAATTACCCTTCAGTAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917693803 Original CRISPR AAATTACCCTTCAGTAATGA AGG Intergenic
No off target data available for this crispr