ID: 917701299

View in Genome Browser
Species Human (GRCh38)
Location 1:177584248-177584270
Sequence CAATTTTACCATAGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917701299_917701303 -7 Left 917701299 1:177584248-177584270 CCCACTTGCCTATGGTAAAATTG No data
Right 917701303 1:177584264-177584286 AAAATTGAGGCACAATGACTTGG No data
917701299_917701304 10 Left 917701299 1:177584248-177584270 CCCACTTGCCTATGGTAAAATTG No data
Right 917701304 1:177584281-177584303 ACTTGGCCAAGCTCTCATAGTGG No data
917701299_917701306 25 Left 917701299 1:177584248-177584270 CCCACTTGCCTATGGTAAAATTG No data
Right 917701306 1:177584296-177584318 CATAGTGGTAGAATTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917701299 Original CRISPR CAATTTTACCATAGGCAAGT GGG (reversed) Intergenic
No off target data available for this crispr