ID: 917701354

View in Genome Browser
Species Human (GRCh38)
Location 1:177584875-177584897
Sequence GGGTGAATTACATTTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917701354_917701360 21 Left 917701354 1:177584875-177584897 CCAATGGGAAATGTAATTCACCC No data
Right 917701360 1:177584919-177584941 CTAGATGGAATTACCTACCAAGG No data
917701354_917701358 6 Left 917701354 1:177584875-177584897 CCAATGGGAAATGTAATTCACCC No data
Right 917701358 1:177584904-177584926 CTCAAGTGAAGAGACCTAGATGG No data
917701354_917701362 26 Left 917701354 1:177584875-177584897 CCAATGGGAAATGTAATTCACCC No data
Right 917701362 1:177584924-177584946 TGGAATTACCTACCAAGGGATGG No data
917701354_917701361 22 Left 917701354 1:177584875-177584897 CCAATGGGAAATGTAATTCACCC No data
Right 917701361 1:177584920-177584942 TAGATGGAATTACCTACCAAGGG No data
917701354_917701363 27 Left 917701354 1:177584875-177584897 CCAATGGGAAATGTAATTCACCC No data
Right 917701363 1:177584925-177584947 GGAATTACCTACCAAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917701354 Original CRISPR GGGTGAATTACATTTCCCAT TGG (reversed) Intergenic
No off target data available for this crispr