ID: 917704300

View in Genome Browser
Species Human (GRCh38)
Location 1:177616111-177616133
Sequence CAGCAGTAAGAGGGGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917704300_917704307 1 Left 917704300 1:177616111-177616133 CCACAGTGCCCCTCTTACTGCTG No data
Right 917704307 1:177616135-177616157 CAAAGAATGGCTTCCTGTTTGGG No data
917704300_917704306 0 Left 917704300 1:177616111-177616133 CCACAGTGCCCCTCTTACTGCTG No data
Right 917704306 1:177616134-177616156 CCAAAGAATGGCTTCCTGTTTGG No data
917704300_917704309 20 Left 917704300 1:177616111-177616133 CCACAGTGCCCCTCTTACTGCTG No data
Right 917704309 1:177616154-177616176 TGGGAAACTCCACTGCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917704300 Original CRISPR CAGCAGTAAGAGGGGCACTG TGG (reversed) Intergenic
No off target data available for this crispr