ID: 917704491

View in Genome Browser
Species Human (GRCh38)
Location 1:177618303-177618325
Sequence CAGAGGAAACAGAAAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917704487_917704491 10 Left 917704487 1:177618270-177618292 CCATAAGATTAGCTGAAAATTTA No data
Right 917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917704491 Original CRISPR CAGAGGAAACAGAAAGATCA AGG Intergenic
No off target data available for this crispr