ID: 917704497

View in Genome Browser
Species Human (GRCh38)
Location 1:177618344-177618366
Sequence CTGCTGTCTTTGGACATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917704497_917704501 -1 Left 917704497 1:177618344-177618366 CCTGGTATGTCCAAAGACAGCAG No data
Right 917704501 1:177618366-177618388 GTAAGGCAATGTACTCAAGTGGG No data
917704497_917704500 -2 Left 917704497 1:177618344-177618366 CCTGGTATGTCCAAAGACAGCAG No data
Right 917704500 1:177618365-177618387 AGTAAGGCAATGTACTCAAGTGG No data
917704497_917704503 10 Left 917704497 1:177618344-177618366 CCTGGTATGTCCAAAGACAGCAG No data
Right 917704503 1:177618377-177618399 TACTCAAGTGGGAAAAGCAAGGG No data
917704497_917704502 9 Left 917704497 1:177618344-177618366 CCTGGTATGTCCAAAGACAGCAG No data
Right 917704502 1:177618376-177618398 GTACTCAAGTGGGAAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917704497 Original CRISPR CTGCTGTCTTTGGACATACC AGG (reversed) Intergenic
No off target data available for this crispr