ID: 917707710

View in Genome Browser
Species Human (GRCh38)
Location 1:177651014-177651036
Sequence AGTTTAATGATGCCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917707710_917707714 28 Left 917707710 1:177651014-177651036 CCAGATTTTGGCATCATTAAACT No data
Right 917707714 1:177651065-177651087 TGCCATGTTAATCATTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917707710 Original CRISPR AGTTTAATGATGCCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr