ID: 917708707

View in Genome Browser
Species Human (GRCh38)
Location 1:177661129-177661151
Sequence TTATTTCAACTCTACATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917708707_917708711 10 Left 917708707 1:177661129-177661151 CCAAAAATGTAGAGTTGAAATAA No data
Right 917708711 1:177661162-177661184 ACATGGGATAAATAACAGGATGG No data
917708707_917708712 27 Left 917708707 1:177661129-177661151 CCAAAAATGTAGAGTTGAAATAA No data
Right 917708712 1:177661179-177661201 GGATGGAATAGAGCTAAAGAAGG No data
917708707_917708709 -6 Left 917708707 1:177661129-177661151 CCAAAAATGTAGAGTTGAAATAA No data
Right 917708709 1:177661146-177661168 AAATAAAGAACACAATACATGGG No data
917708707_917708710 6 Left 917708707 1:177661129-177661151 CCAAAAATGTAGAGTTGAAATAA No data
Right 917708710 1:177661158-177661180 CAATACATGGGATAAATAACAGG No data
917708707_917708708 -7 Left 917708707 1:177661129-177661151 CCAAAAATGTAGAGTTGAAATAA No data
Right 917708708 1:177661145-177661167 GAAATAAAGAACACAATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917708707 Original CRISPR TTATTTCAACTCTACATTTT TGG (reversed) Intergenic
No off target data available for this crispr