ID: 917717798

View in Genome Browser
Species Human (GRCh38)
Location 1:177755677-177755699
Sequence CCTGCAGTCCGCCTCTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917717795_917717798 0 Left 917717795 1:177755654-177755676 CCTGAAAGGTAAGAATAAGATTC No data
Right 917717798 1:177755677-177755699 CCTGCAGTCCGCCTCTGCACAGG No data
917717793_917717798 30 Left 917717793 1:177755624-177755646 CCACGCTTTGTTTAACTTCTCTA No data
Right 917717798 1:177755677-177755699 CCTGCAGTCCGCCTCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917717798 Original CRISPR CCTGCAGTCCGCCTCTGCAC AGG Intergenic
No off target data available for this crispr