ID: 917718064

View in Genome Browser
Species Human (GRCh38)
Location 1:177758089-177758111
Sequence TTCGGATACAAATTCATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917718061_917718064 16 Left 917718061 1:177758050-177758072 CCATTCACTTTAGGAGAGTTATT No data
Right 917718064 1:177758089-177758111 TTCGGATACAAATTCATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917718064 Original CRISPR TTCGGATACAAATTCATCAA AGG Intergenic
No off target data available for this crispr