ID: 917719979

View in Genome Browser
Species Human (GRCh38)
Location 1:177778085-177778107
Sequence CTGTGGAAGAGGAATGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917719979_917719986 7 Left 917719979 1:177778085-177778107 CCATACACATTCCTCTTCCACAG No data
Right 917719986 1:177778115-177778137 TCAGGCTGTTGGATGCATTTCGG No data
917719979_917719987 8 Left 917719979 1:177778085-177778107 CCATACACATTCCTCTTCCACAG No data
Right 917719987 1:177778116-177778138 CAGGCTGTTGGATGCATTTCGGG No data
917719979_917719988 9 Left 917719979 1:177778085-177778107 CCATACACATTCCTCTTCCACAG No data
Right 917719988 1:177778117-177778139 AGGCTGTTGGATGCATTTCGGGG No data
917719979_917719983 -4 Left 917719979 1:177778085-177778107 CCATACACATTCCTCTTCCACAG No data
Right 917719983 1:177778104-177778126 ACAGCCACACCTCAGGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917719979 Original CRISPR CTGTGGAAGAGGAATGTGTA TGG (reversed) Intergenic
No off target data available for this crispr