ID: 917720865

View in Genome Browser
Species Human (GRCh38)
Location 1:177785277-177785299
Sequence GCCTCCTGCCTTTGTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917720865_917720875 16 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720875 1:177785316-177785338 TCAAGGTCACCCTGGGGGCTGGG No data
917720865_917720877 22 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720877 1:177785322-177785344 TCACCCTGGGGGCTGGGGCTTGG No data
917720865_917720871 9 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720871 1:177785309-177785331 CATTGCATCAAGGTCACCCTGGG No data
917720865_917720873 11 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720873 1:177785311-177785333 TTGCATCAAGGTCACCCTGGGGG No data
917720865_917720867 -1 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720867 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
917720865_917720872 10 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720872 1:177785310-177785332 ATTGCATCAAGGTCACCCTGGGG No data
917720865_917720870 8 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720870 1:177785308-177785330 CCATTGCATCAAGGTCACCCTGG No data
917720865_917720876 17 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720876 1:177785317-177785339 CAAGGTCACCCTGGGGGCTGGGG No data
917720865_917720874 15 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720874 1:177785315-177785337 ATCAAGGTCACCCTGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917720865 Original CRISPR GCCTCCTGCCTTTGTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr