ID: 917720866

View in Genome Browser
Species Human (GRCh38)
Location 1:177785299-177785321
Sequence CCTTGATGCAATGGAGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917720866_917720883 18 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720883 1:177785340-177785362 CTTGGTTATCAGTCTTCAGGGGG No data
917720866_917720877 0 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720877 1:177785322-177785344 TCACCCTGGGGGCTGGGGCTTGG No data
917720866_917720881 16 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720881 1:177785338-177785360 GGCTTGGTTATCAGTCTTCAGGG No data
917720866_917720875 -6 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720875 1:177785316-177785338 TCAAGGTCACCCTGGGGGCTGGG No data
917720866_917720874 -7 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720874 1:177785315-177785337 ATCAAGGTCACCCTGGGGGCTGG No data
917720866_917720876 -5 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720876 1:177785317-177785339 CAAGGTCACCCTGGGGGCTGGGG No data
917720866_917720885 24 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720885 1:177785346-177785368 TATCAGTCTTCAGGGGGTCAGGG No data
917720866_917720882 17 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720882 1:177785339-177785361 GCTTGGTTATCAGTCTTCAGGGG No data
917720866_917720884 23 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720884 1:177785345-177785367 TTATCAGTCTTCAGGGGGTCAGG No data
917720866_917720880 15 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720880 1:177785337-177785359 GGGCTTGGTTATCAGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917720866 Original CRISPR CCTTGATGCAATGGAGGCAA TGG (reversed) Intergenic
No off target data available for this crispr