ID: 917720871

View in Genome Browser
Species Human (GRCh38)
Location 1:177785309-177785331
Sequence CATTGCATCAAGGTCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917720865_917720871 9 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720871 1:177785309-177785331 CATTGCATCAAGGTCACCCTGGG No data
917720862_917720871 14 Left 917720862 1:177785272-177785294 CCTCTCCTGCTGCACAAAGGCAG No data
Right 917720871 1:177785309-177785331 CATTGCATCAAGGTCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917720871 Original CRISPR CATTGCATCAAGGTCACCCT GGG Intergenic
No off target data available for this crispr