ID: 917720871 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:177785309-177785331 |
Sequence | CATTGCATCAAGGTCACCCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
917720862_917720871 | 14 | Left | 917720862 | 1:177785272-177785294 | CCTCTCCTGCTGCACAAAGGCAG | No data | ||
Right | 917720871 | 1:177785309-177785331 | CATTGCATCAAGGTCACCCTGGG | No data | ||||
917720865_917720871 | 9 | Left | 917720865 | 1:177785277-177785299 | CCTGCTGCACAAAGGCAGGAGGC | No data | ||
Right | 917720871 | 1:177785309-177785331 | CATTGCATCAAGGTCACCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
917720871 | Original CRISPR | CATTGCATCAAGGTCACCCT GGG | Intergenic | ||