ID: 917720873

View in Genome Browser
Species Human (GRCh38)
Location 1:177785311-177785333
Sequence TTGCATCAAGGTCACCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917720865_917720873 11 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720873 1:177785311-177785333 TTGCATCAAGGTCACCCTGGGGG No data
917720862_917720873 16 Left 917720862 1:177785272-177785294 CCTCTCCTGCTGCACAAAGGCAG No data
Right 917720873 1:177785311-177785333 TTGCATCAAGGTCACCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917720873 Original CRISPR TTGCATCAAGGTCACCCTGG GGG Intergenic
No off target data available for this crispr