ID: 917720875

View in Genome Browser
Species Human (GRCh38)
Location 1:177785316-177785338
Sequence TCAAGGTCACCCTGGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917720862_917720875 21 Left 917720862 1:177785272-177785294 CCTCTCCTGCTGCACAAAGGCAG No data
Right 917720875 1:177785316-177785338 TCAAGGTCACCCTGGGGGCTGGG No data
917720865_917720875 16 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720875 1:177785316-177785338 TCAAGGTCACCCTGGGGGCTGGG No data
917720866_917720875 -6 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720875 1:177785316-177785338 TCAAGGTCACCCTGGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917720875 Original CRISPR TCAAGGTCACCCTGGGGGCT GGG Intergenic
No off target data available for this crispr