ID: 917720877

View in Genome Browser
Species Human (GRCh38)
Location 1:177785322-177785344
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917720865_917720877 22 Left 917720865 1:177785277-177785299 CCTGCTGCACAAAGGCAGGAGGC No data
Right 917720877 1:177785322-177785344 TCACCCTGGGGGCTGGGGCTTGG No data
917720869_917720877 -9 Left 917720869 1:177785308-177785330 CCATTGCATCAAGGTCACCCTGG No data
Right 917720877 1:177785322-177785344 TCACCCTGGGGGCTGGGGCTTGG No data
917720866_917720877 0 Left 917720866 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG No data
Right 917720877 1:177785322-177785344 TCACCCTGGGGGCTGGGGCTTGG No data
917720862_917720877 27 Left 917720862 1:177785272-177785294 CCTCTCCTGCTGCACAAAGGCAG No data
Right 917720877 1:177785322-177785344 TCACCCTGGGGGCTGGGGCTTGG No data
917720868_917720877 -6 Left 917720868 1:177785305-177785327 CCTCCATTGCATCAAGGTCACCC No data
Right 917720877 1:177785322-177785344 TCACCCTGGGGGCTGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr