ID: 917723545

View in Genome Browser
Species Human (GRCh38)
Location 1:177809079-177809101
Sequence GAGGGTAATTTTCACTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917723545_917723553 25 Left 917723545 1:177809079-177809101 CCCACCAAGTGAAAATTACCCTC No data
Right 917723553 1:177809127-177809149 ACAGCCCCATTCCACAAGCAAGG No data
917723545_917723550 -9 Left 917723545 1:177809079-177809101 CCCACCAAGTGAAAATTACCCTC No data
Right 917723550 1:177809093-177809115 ATTACCCTCTTGCAAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917723545 Original CRISPR GAGGGTAATTTTCACTTGGT GGG (reversed) Intergenic
No off target data available for this crispr