ID: 917728103

View in Genome Browser
Species Human (GRCh38)
Location 1:177846969-177846991
Sequence GATTTTAAGCAGTGTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917728103_917728106 -8 Left 917728103 1:177846969-177846991 CCAGCCACACACTGCTTAAAATC No data
Right 917728106 1:177846984-177847006 TTAAAATCTTGGCATCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917728103 Original CRISPR GATTTTAAGCAGTGTGTGGC TGG (reversed) Intergenic
No off target data available for this crispr