ID: 917731076

View in Genome Browser
Species Human (GRCh38)
Location 1:177875666-177875688
Sequence CCTTCAGCAGGGTGGCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917731076_917731085 2 Left 917731076 1:177875666-177875688 CCCCAGTGCCACCCTGCTGAAGG No data
Right 917731085 1:177875691-177875713 CTGATTAGCATTTCTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917731076 Original CRISPR CCTTCAGCAGGGTGGCACTG GGG (reversed) Intergenic
No off target data available for this crispr