ID: 917732256

View in Genome Browser
Species Human (GRCh38)
Location 1:177886482-177886504
Sequence CTGCTGTTCTGGGGCAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917732256_917732264 19 Left 917732256 1:177886482-177886504 CCAAGTTTGCCCCAGAACAGCAG No data
Right 917732264 1:177886524-177886546 GACTCATGAGTATTGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917732256 Original CRISPR CTGCTGTTCTGGGGCAAACT TGG (reversed) Intergenic
No off target data available for this crispr