ID: 917736183

View in Genome Browser
Species Human (GRCh38)
Location 1:177922504-177922526
Sequence CCAGAACCACACATAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917736183 Original CRISPR CCAGAACCACACATAGAAAG TGG (reversed) Intergenic
900890730 1:5447929-5447951 CCAGAACAACACAGAGCATGTGG + Intergenic
902145834 1:14398333-14398355 CCAAAATCACAGATAGTAAGTGG - Intergenic
903372903 1:22848335-22848357 CCAGCACCACTCAGAGATAGTGG + Intronic
904930771 1:34085673-34085695 CCAGAATTAAACAAAGAAAGGGG - Intronic
907213772 1:52844458-52844480 CCAGAACTAGACAGAGAAAATGG - Intronic
907361269 1:53917466-53917488 CCAGTATCACACATAGTAAAAGG + Intronic
908313941 1:62914110-62914132 CCAAGATCACACATAGAAAGTGG + Intergenic
908813779 1:68011053-68011075 CCAGGACCACATAAAGAAACAGG - Intergenic
909657624 1:78048352-78048374 CCAGAATTACACATAGCAAGTGG + Intronic
911563223 1:99431752-99431774 CCAGAATTAAACAAAGAAAGAGG - Intergenic
914337915 1:146732560-146732582 TCAGAAGCAAACAGAGAAAGTGG + Intergenic
916570208 1:166018968-166018990 CCAGAATCATACCTAGAATGTGG - Intergenic
917736183 1:177922504-177922526 CCAGAACCACACATAGAAAGTGG - Intergenic
921148429 1:212380676-212380698 CCAGAAGCAGACATAGATATTGG - Intronic
923199547 1:231698126-231698148 ACAGAAACACACATAGAACAAGG + Intronic
1064233229 10:13548564-13548586 CCTGAAGCACTCAAAGAAAGTGG - Intergenic
1064939260 10:20714414-20714436 AGAGAACCACTCATAGAATGTGG + Intergenic
1066513312 10:36126575-36126597 CCAATACCACTCATATAAAGAGG + Intergenic
1074693352 10:116026543-116026565 CCAGCCCCACACAGAGACAGAGG - Intergenic
1075979755 10:126727285-126727307 CCAGATCCACGCATATAGAGAGG + Intergenic
1076014249 10:127015101-127015123 GAAGAACCACCAATAGAAAGCGG - Intronic
1076052270 10:127345378-127345400 CCAGTCCCACACCTAGAATGTGG + Intronic
1078903288 11:15661427-15661449 CCAGAGCCACACAGAGTAAATGG - Intergenic
1079975382 11:27084300-27084322 CCAGAAACACTCATAGAAGATGG - Intronic
1080149386 11:29031397-29031419 CAAGAACCACACATAGCTATTGG - Intergenic
1080470781 11:32543432-32543454 TCAGAACCCCACATAAACAGAGG + Intergenic
1080567257 11:33522511-33522533 CCAGAAACACACAAGAAAAGTGG - Intergenic
1081546983 11:44078615-44078637 CCAGAGCCACACAGTCAAAGGGG - Intronic
1082776209 11:57246224-57246246 CCATAGCCACACATGGCAAGTGG - Intergenic
1083889688 11:65589665-65589687 CCAGAGCCACTCATACAGAGGGG - Intronic
1083894835 11:65614581-65614603 ACAGAACCACACTTGGGAAGGGG + Intronic
1086790212 11:91027919-91027941 CCAGAACCTCACTCAGAGAGAGG - Intergenic
1086818231 11:91400590-91400612 CCAGACCCACACATCCCAAGAGG + Intergenic
1087275671 11:96158337-96158359 CCAGGCCCACACATAGAGATAGG + Intronic
1087867175 11:103245056-103245078 TCAGAATCACACATTGAATGGGG - Intronic
1088654145 11:111983252-111983274 CCAGAGCCACACACATAATGTGG - Intronic
1089260515 11:117220911-117220933 TCAGAACCACACAGAGAGAAGGG - Intronic
1091870218 12:3883669-3883691 ACAGAACCATACTCAGAAAGAGG + Intergenic
1093999927 12:25684012-25684034 TCAGAACCAGACAGAGGAAGAGG - Intergenic
1094094028 12:26683590-26683612 ACAGAAGCACACATAGAACAAGG + Intronic
1094535971 12:31323704-31323726 CTAGAAACACACAAAGAAACTGG + Intronic
1096593451 12:52677951-52677973 CCAGCACCTTACATAGTAAGTGG - Intronic
1096677933 12:53235494-53235516 CCAGATCCCCACATAGAATAAGG + Intergenic
1098888045 12:75980203-75980225 CATCAAGCACACATAGAAAGGGG + Intergenic
1103045990 12:117734994-117735016 CCAGAAACGCACCCAGAAAGTGG - Intronic
1104863334 12:131937136-131937158 CCAGATCCACACATGGAACGTGG - Intronic
1105304606 13:19159886-19159908 CCAGAACCACACAAACCCAGAGG + Intergenic
1105718192 13:23088142-23088164 CCCCAACCACACATGGGAAGGGG + Intergenic
1108266785 13:48718410-48718432 CCAGAACCATATATTGAAAAAGG + Intergenic
1112870790 13:103968421-103968443 ACAGAACTAGAGATAGAAAGAGG + Intergenic
1116442868 14:44974751-44974773 CCAGACACACACACCGAAAGGGG - Intronic
1119636002 14:76273938-76273960 CCAGTACCACAAAGAGAGAGGGG - Intergenic
1120215158 14:81674065-81674087 ACAGAACCACATGTTGAAAGAGG + Intergenic
1121235071 14:92386163-92386185 CTAGAACCACCTATCGAAAGGGG - Intronic
1121576284 14:94990792-94990814 CCAGAATCACAGTTAGGAAGGGG - Intergenic
1123666487 15:22612602-22612624 TCACAACCACAGATAGGAAGGGG + Intergenic
1125977645 15:43969483-43969505 TCAGAAGCACACATAGAACTGGG - Intronic
1127043732 15:55004268-55004290 GCAGAAGCACACACAGAAAGCGG + Intergenic
1129612540 15:77071896-77071918 CCAGAGCCACACATAGTAAGTGG + Intronic
1130675291 15:85946938-85946960 CCAGACCCACATATGCAAAGTGG - Intergenic
1133246243 16:4450691-4450713 ACAGAAACACACACAGAGAGAGG - Intronic
1134785148 16:16935453-16935475 ACAGAAACACACATAAAATGAGG - Intergenic
1135782921 16:25322014-25322036 CCCGACACACACATAGAAAGGGG - Intergenic
1135853566 16:25986277-25986299 CCAGAACCAGGCATTGAAACTGG + Intronic
1136586209 16:31186946-31186968 CCAGAACCACCTCCAGAAAGGGG + Intronic
1137633026 16:49960866-49960888 GCAGAACCACGCAGAGGAAGTGG - Intergenic
1138941550 16:61797082-61797104 CCACACACACACACAGAAAGAGG - Intronic
1139035018 16:62934720-62934742 CCATAACAATGCATAGAAAGTGG - Intergenic
1139996363 16:70984775-70984797 TCAGAAGCAAACAGAGAAAGTGG - Intronic
1140333985 16:74086196-74086218 CCAAAAGCAAAAATAGAAAGTGG - Intergenic
1140985391 16:80153685-80153707 ACAGAGCCACACATAGCAAATGG + Intergenic
1141721622 16:85759224-85759246 TCAAAAACACACATAGAAAGAGG + Intergenic
1142949796 17:3469682-3469704 TCTGAACCACACCTACAAAGAGG + Intronic
1147894564 17:43742103-43742125 CCAGCACCTCACATGGAGAGGGG + Intergenic
1148207508 17:45788410-45788432 ACATGACCTCACATAGAAAGAGG + Intronic
1148497004 17:48059038-48059060 CCACAACCACACATACAACATGG + Exonic
1149645761 17:58240450-58240472 CCAGAACCACACAGGGCAAGAGG - Intronic
1154219598 18:12440636-12440658 ACAAAAGCACACACAGAAAGTGG + Intergenic
1155399456 18:25422080-25422102 CTAGAATAACTCATAGAAAGAGG + Intergenic
1156820511 18:41366746-41366768 CTAGAAGGACACAAAGAAAGAGG - Intergenic
1157786207 18:50485237-50485259 CCAGGACCACACACTGATAGAGG + Intergenic
1158549913 18:58426958-58426980 GCAGAACCAGACAGAGAGAGTGG - Intergenic
1158909351 18:62044288-62044310 GCAAAACTACACATAGAAAAAGG + Exonic
1161373069 19:3924401-3924423 TCAGAGCCACACTTAGAAAGTGG + Intronic
1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG + Intergenic
1163507601 19:17717541-17717563 CCAGAACCAAAAAGAGAGAGAGG + Intergenic
1164076432 19:21823101-21823123 TCAGAACAATACAAAGAAAGTGG + Intronic
926819128 2:16833629-16833651 CCTGAAACACACATAGAATTAGG + Intergenic
928050235 2:27985720-27985742 CCAGAGCCACAAATACACAGCGG - Intronic
929247466 2:39718700-39718722 CCAAACCCACACAGAGAAAAAGG - Intergenic
931152047 2:59585219-59585241 CCAGAGCCACTCAGAGGAAGGGG + Intergenic
931807222 2:65818885-65818907 CCAGAAACACAAATGGAATGCGG - Intergenic
932089572 2:68793508-68793530 CCAGAACCACTTATTGAAAAGGG + Intronic
932593030 2:73078538-73078560 CCAGAACTACATATGGGAAGTGG - Intronic
934756200 2:96826634-96826656 CCCCAACCACACAGAGAGAGGGG - Intronic
935034971 2:99361523-99361545 CCAGGTCCTAACATAGAAAGTGG + Exonic
935059997 2:99599043-99599065 CCAAAACCACACATAGCATCAGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935833772 2:107027399-107027421 TAAGAACCACAAATAAAAAGAGG + Intergenic
937471065 2:122174344-122174366 CCATAACCTCACAGAGAAAAGGG - Intergenic
938967508 2:136401586-136401608 TCAGAAGCACACTTAGGAAGGGG + Intergenic
939848706 2:147278694-147278716 CCAGAACCACACTGAAAAACTGG - Intergenic
941195784 2:162449677-162449699 CCAGAACCTCAAATAGAGACAGG + Intronic
941250009 2:163149515-163149537 CCAGAACAAGCCAAAGAAAGAGG - Intergenic
941384522 2:164837844-164837866 ACAGAACAACAAATATAAAGTGG + Intronic
942261417 2:174168262-174168284 CCAGAACCATGCATAGGGAGGGG + Intronic
942643552 2:178086770-178086792 CCAGAACCCCACATAAAAGTAGG + Intronic
943374233 2:187055248-187055270 CCAGGAACAGACATGGAAAGGGG - Intergenic
943508619 2:188795227-188795249 CAAGAACTACAAATAGAAGGAGG - Intergenic
946298379 2:218805271-218805293 ACAGAGACAGACATAGAAAGGGG - Intronic
947757808 2:232580829-232580851 ACAGAAGCACACATATACAGGGG - Intronic
948840841 2:240648136-240648158 CCAAGACCAGACATAGGAAGCGG + Intergenic
1170003888 20:11645574-11645596 CCAGAACCACAGTTCAAAAGGGG + Intergenic
1171219559 20:23382664-23382686 ACAGTACCATACATAAAAAGTGG + Intronic
1172240419 20:33409095-33409117 CCAGCAGCACAAGTAGAAAGGGG + Intronic
1174211125 20:48878779-48878801 CCAGAACCACTCATAGCATGTGG + Intergenic
1174550600 20:51358825-51358847 CCCAAACCACAGCTAGAAAGTGG - Intergenic
1175497143 20:59423032-59423054 CCACACCCACACAGGGAAAGGGG - Intergenic
1178635222 21:34296586-34296608 ATAGAAACACACATAGAAGGAGG - Intergenic
1178684734 21:34702187-34702209 CCGGAAACCCTCATAGAAAGGGG + Intronic
1178930996 21:36819110-36819132 ACAGAAGCACACCTAGAAACTGG + Intronic
1180878289 22:19185636-19185658 ACAAAGCCACAGATAGAAAGTGG - Intronic
1182566563 22:31204535-31204557 CCAGGGCCACAAATAGGAAGAGG - Exonic
1183922385 22:41179190-41179212 CTTGAACCACACACACAAAGGGG - Exonic
1184983799 22:48115449-48115471 CCTGAACCAGACATAGCGAGGGG - Intergenic
949663453 3:6308837-6308859 CCAGCACCATTCATAGAAAAGGG - Intergenic
949875498 3:8623740-8623762 CCAGAGCCAGACAGAGAAGGGGG + Intronic
949923740 3:9024196-9024218 CCAGAACCACTCAGAGAAGAAGG + Intronic
950577195 3:13839255-13839277 CCAGACCCACACATGGAACCGGG + Intronic
950946043 3:16947406-16947428 CTAGAACCACACTCAGAAAATGG + Intronic
952419465 3:33118267-33118289 TCAGAACAGCACTTAGAAAGAGG - Intronic
953708041 3:45245893-45245915 CCAGTCACACAGATAGAAAGAGG + Intergenic
954235692 3:49255511-49255533 CCCAAAACACACTTAGAAAGAGG - Intronic
955621691 3:60871079-60871101 CAAGAACCACAGATGGAAACGGG - Intronic
956390236 3:68764229-68764251 CCATACCCCCACAGAGAAAGAGG + Intronic
957015234 3:75055601-75055623 CCAGAACCTAACACAGAAACTGG - Intergenic
957103346 3:75854873-75854895 CCAGAATCACACAATGAGAGAGG + Intergenic
957103972 3:75862629-75862651 TTACAAACACACATAGAAAGGGG - Intergenic
957385421 3:79490317-79490339 CCAGTACAGCACATACAAAGGGG - Intronic
960767701 3:121154796-121154818 CCAGAAGAAAACATAGAAGGAGG - Intronic
961119187 3:124358987-124359009 CCAGATCCACACATGGAAAGAGG - Intronic
962686579 3:137853653-137853675 CCAGACCCAGAGAGAGAAAGTGG - Intergenic
963141353 3:141948580-141948602 CCATAACCACACTGAGAGAGGGG - Intergenic
966405901 3:179597984-179598006 CCAGAACTACAAATGTAAAGTGG + Intronic
966699011 3:182824234-182824256 AGAGAACCACACAAAGAAAATGG - Intronic
967046178 3:185739325-185739347 GCAGAAAAACACATACAAAGGGG + Intronic
969566910 4:7984201-7984223 CCAGAACCACACGGGGCAAGTGG - Intronic
970810716 4:20090617-20090639 CCAGAGCCAAACCTGGAAAGTGG - Intergenic
971408496 4:26344761-26344783 CCATAACCCCACATATACAGTGG - Intronic
972221771 4:36964187-36964209 CCAGCTCCAGAAATAGAAAGGGG - Intergenic
972694680 4:41433971-41433993 CCAGAACCCTAAAAAGAAAGTGG - Intronic
974991086 4:69091772-69091794 CCAGATAAACTCATAGAAAGGGG + Intronic
976766182 4:88600407-88600429 ACAGAAACACACATAAAAAAAGG - Intronic
977380244 4:96263845-96263867 TCAGAAACACACATAGACACCGG - Intergenic
977788243 4:101066100-101066122 CCACAGTCACACTTAGAAAGAGG + Intronic
978050150 4:104189169-104189191 CTAGAACCACAAAAAAAAAGTGG + Intergenic
978896772 4:113897962-113897984 CCTGTACCAGAAATAGAAAGTGG + Intergenic
979558598 4:122077863-122077885 CCAGGGCCACAAATAGGAAGAGG + Intergenic
985189351 4:187354976-187354998 TCAGAAGCACACAGAGCAAGAGG + Intergenic
985196564 4:187436453-187436475 CAAGAAACACAGACAGAAAGGGG - Intergenic
986775023 5:11006423-11006445 CCAGAGCCACAGATGGAAGGAGG + Intronic
987270417 5:16302757-16302779 CCAGAAACACTCAGAGGAAGGGG + Intergenic
988531684 5:32033235-32033257 ACAAAACCACACACAGAAAAGGG + Intronic
990070952 5:51782062-51782084 CCTGATCCAGACCTAGAAAGAGG + Intergenic
993952831 5:94197478-94197500 ACAAAACCACAAATAGAAAGTGG - Intronic
994451778 5:99952168-99952190 CCAAGACCAAACATAGAAAAAGG - Intergenic
994812832 5:104544247-104544269 ATAGAAACACACATAAAAAGTGG - Intergenic
995569276 5:113462240-113462262 CCAGAAACAAAAGTAGAAAGTGG - Intronic
997611361 5:135218021-135218043 CCTGAAACACACATAGGAACGGG - Intronic
999325984 5:150643865-150643887 GCAGAACCACATCAAGAAAGCGG + Intronic
1000107347 5:158072880-158072902 CCACACCCACACACAGAAACAGG - Intergenic
1001549160 5:172589776-172589798 ACAGAAACACACATACAACGAGG + Intergenic
1001654939 5:173342165-173342187 TCAGAGCCACACATGGCAAGTGG - Intergenic
1003685265 6:8296363-8296385 CCAGAAACTTACATACAAAGTGG + Intergenic
1004083234 6:12416939-12416961 CCAGATTCACACAGAGCAAGAGG + Intergenic
1005126327 6:22450673-22450695 CCAAAACCACAGATAGAGATAGG - Intergenic
1006205562 6:32338672-32338694 CCAGTAACACTCAAAGAAAGAGG - Intronic
1006441934 6:34058513-34058535 CCAGAACCTCACAGAGAGTGAGG - Intronic
1008544919 6:52576312-52576334 CCAGAAAATCACATAGGAAGTGG + Intronic
1008578369 6:52882726-52882748 CCAGAACCTCACACAGAATCTGG + Intronic
1008806597 6:55437265-55437287 CAAGAACCTCACGTAGAATGTGG + Intronic
1013023714 6:106247629-106247651 ACAGAAACACACATAGAACAAGG - Intronic
1013373220 6:109488573-109488595 CCAGAACCACCCATAGTTAAGGG + Intergenic
1013629570 6:111973146-111973168 CCTGAACAACACACAGACAGTGG - Intergenic
1013753579 6:113435433-113435455 CCAGAATGAGACACAGAAAGAGG - Intergenic
1014843240 6:126244003-126244025 GCAGAAACTCACGTAGAAAGTGG - Intergenic
1015715946 6:136191929-136191951 CCAGGACAACACTCAGAAAGTGG - Exonic
1016988092 6:149910039-149910061 CCAGAAACAGACCAAGAAAGAGG - Intergenic
1017711691 6:157174675-157174697 ACAAAACCACACATAGATAAAGG - Intronic
1019328894 7:453064-453086 CCAGAAGCACACCTGGAGAGGGG - Intergenic
1020261467 7:6532750-6532772 CCAGAACCACACATGGCCAAAGG + Intronic
1020459576 7:8413290-8413312 CCATAGCCACACATGGAATGAGG + Intergenic
1021252308 7:18345637-18345659 CCTGGAACATACATAGAAAGAGG + Intronic
1022909828 7:34890025-34890047 CCTCAAACCCACATAGAAAGAGG + Intergenic
1023351387 7:39323447-39323469 CCACTTCCACACATAGAAACAGG - Intronic
1023560889 7:41472190-41472212 CCAAAACAACACACAGAAACTGG + Intergenic
1023806268 7:43875204-43875226 CAAGAAACACAAAGAGAAAGAGG + Intronic
1024160098 7:46664946-46664968 CCAGAGCCACAGATAGAAAGTGG + Intergenic
1024206500 7:47166672-47166694 CTACAATCACACCTAGAAAGTGG + Intergenic
1024903918 7:54354212-54354234 TGAGAAACACACATAGAAAGAGG + Intergenic
1026151760 7:67793925-67793947 CCAGAAAAAAAAATAGAAAGGGG + Intergenic
1032508037 7:132450763-132450785 CCAGAATCTCAGAGAGAAAGAGG - Intronic
1033650956 7:143343103-143343125 CCAGAAACACACATACAACAAGG - Intronic
1035439331 7:158883126-158883148 CCAGGACAACAGATAGAAACTGG + Intronic
1035786494 8:2265258-2265280 CTAGATCTACACATAGAGAGAGG - Intergenic
1035806313 8:2456458-2456480 CTAGATCTACACATAGAGAGAGG + Intergenic
1035945011 8:3953457-3953479 CCATAAACACACACAGAGAGAGG + Intronic
1036706161 8:11048786-11048808 CCAGAACCACGCAGAGCCAGGGG - Intronic
1037894779 8:22644597-22644619 CTAGAACCTCACATAGACTGAGG - Intronic
1038134583 8:24771400-24771422 CCCCACCCACACACAGAAAGGGG + Intergenic
1040737306 8:50523926-50523948 CCAAAACCACAGAGATAAAGTGG - Intronic
1041037362 8:53807891-53807913 CCAGAACCACATATGGTTAGGGG + Intronic
1041393444 8:57368274-57368296 CCAGAACCCCAAAGATAAAGAGG + Intergenic
1042770949 8:72381981-72382003 CTAGTACCACACAAAGAAAAGGG - Intergenic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1044381175 8:91535545-91535567 CCAGAGCCACAGATGGAAAGTGG - Intergenic
1046586582 8:116155617-116155639 CCAAAACCACAGACAGAAATAGG - Intergenic
1047104443 8:121718029-121718051 ACAGAGTCACACATAAAAAGGGG - Intergenic
1047722179 8:127651335-127651357 ACAGAACCACAAAAAGGAAGAGG + Intergenic
1048630738 8:136239544-136239566 AGAGAATCACACATAGGAAGAGG + Intergenic
1049179752 8:141216175-141216197 CCAGCACCACAGACAGAAATTGG + Intronic
1051446749 9:17148411-17148433 ACAGAAACACACATAAAATGAGG - Intronic
1051491714 9:17674016-17674038 CAAGAGCCACACAAGGAAAGAGG - Intronic
1053591474 9:39518643-39518665 CCAGACCTAAACATACAAAGAGG + Intergenic
1053849319 9:42274002-42274024 CCAGACCTAAACATACAAAGAGG + Intergenic
1054574833 9:66846646-66846668 CCAGACCTAAACATACAAAGAGG - Intergenic
1055010900 9:71563974-71563996 ACTGAACCACACATACAAAGTGG + Intergenic
1055472408 9:76626063-76626085 ACAGAAACACACATAAAAAAAGG + Intronic
1057767012 9:97930103-97930125 CCAGAACCACACCAAGAAACAGG - Exonic
1058389545 9:104479455-104479477 CCATAAACACTCACAGAAAGAGG - Intergenic
1059415257 9:114158225-114158247 ACAGAAACACACAGGGAAAGTGG - Intronic
1059542188 9:115142138-115142160 AATGAGCCACACATAGAAAGAGG - Intronic
1061173823 9:128979518-128979540 TCAAAGTCACACATAGAAAGAGG + Intronic
1061859835 9:133462289-133462311 CCAGAACCACAGGTACACAGGGG - Intronic
1062132880 9:134909557-134909579 CAAGAAACACACATTGAAACTGG + Intronic
1062626832 9:137447091-137447113 CCAGGAGCAGACATAGAAGGAGG - Intergenic
1202800621 9_KI270719v1_random:171083-171105 ACAGAATCACACAGAGAAACAGG - Intergenic
1185760370 X:2685997-2686019 ACAGATCCCCCCATAGAAAGTGG + Intergenic
1187258898 X:17667298-17667320 CCAGAAGCACAAATGGAGAGAGG + Intronic
1188525524 X:31083845-31083867 CTGCAACCACACAGAGAAAGGGG - Intergenic
1188660823 X:32756632-32756654 ACAGATCTACACATAGATAGAGG + Intronic
1191129501 X:56993232-56993254 CCAGAACCTCAAAATGAAAGAGG - Intronic
1194834334 X:98662355-98662377 CCAGAACCTCGCACAGAAATTGG + Intergenic
1196038536 X:111174633-111174655 CCATAGCCACACATAGCCAGTGG - Intronic
1196510206 X:116500166-116500188 CTTGAACCAGACCTAGAAAGAGG - Intergenic
1200093182 X:153645153-153645175 CCAGGAACACACTGAGAAAGGGG + Intronic
1201236369 Y:11915829-11915851 CCAGAACCACTCAAGGAAGGAGG - Intergenic